Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Methanocaldococcus jannaschii DSM 2661 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1) secondary structure diagram

Methanocaldococcus jannaschii DSM 2661 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1) URS00001612D2_243232

Automated summary: This tRNA sequence is 88 nucleotides long and is found in Methanocaldococcus jannaschii DSM 2661. Annotated by 1 database (GtRNAdb). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Methanocaldococcus jannaschii DSM 2661 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1) sequence is a product of tRNA-Leu-TAG-1-1 gene.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GCAGGGGUCGCCAAGCCUGGCCAAAGGCGCUGGGCCUAGGACCCAGUCCCGUAGGGGUUCCAGGGUUCAAAUCCCUGCCCCUGCACCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 6 other species

    1. Methanocaldococcus bathoardescens tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2. Methanocaldococcus fervens AG86 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3. Methanocaldococcus sp. FS406-22 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4. Methanocaldococcus sp. SG1 tRNA-Leu
    5. Methanocaldococcus sp. SG7 tRNA-Leu
    6. Methanocaldococcus jannaschii RNA (84-MER) from Methanocaldococcus jannaschii (PDB 2ZZM, chain B)
    2D structure Publications New