Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-214 precursor URS0000160683_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Aotus nancymaae microRNA 214 (ENSANAG00000009637.1)
  2. Ateles geoffroyi microRNA age-mir-214 precursor
  3. Callithrix jacchus cja-mir-3120 (ENSCJAG00000030390.3)
  4. Carlito syrichta microRNA 214 (ENSTSYG00000022233.2)
  5. Castor canadensis (American beaver) miRNA (ENSCCNG00000016370.1)
  6. Cavia porcellus microRNA 214 (ENSCPOG00000016605.3)
  7. Cebus imitator (Panamanian white-faced capuchin) microRNA 214 (ENSCCAG00000012171.1)
  8. Cercocebus atys microRNA 214 (ENSCATG00000022725.1)
  9. Chlorocebus sabaeus (African green monkey) microRNA 214 (ENSCSAG00000026679.1)
  10. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000019218.1)
  11. Cricetulus griseus microRNA mir-214 (ENSCGRG00000021251.1, ENSCGRG00001001342.1, ENSCGRG00015011417.2)
  12. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000004387.1)
  13. Gorilla gorilla gorilla ggo-mir-214 (ENSGGOG00000032556.2)
  14. Gorilla gorilla (western gorilla) microRNA ggo-mir-214 precursor
  15. Heterocephalus glaber (naked mole-rat) microRNA mir-214
  16. Homo sapiens microRNA hsa-mir-214 precursor
  17. Macaca fascicularis (Crab-eating macaque) microRNA 214 (ENSMFAG00000020383.2)
  18. Macaca mulatta microRNA mml-mir-214 precursor
  19. Macaca nemestrina microRNA mne-mir-214 precursor
  20. Mandrillus leucophaeus (Drill) microRNA 214 (ENSMLEG00000022217.1)
  21. Meriones unguiculatus (Mongolian gerbil) miRNA (ENSMUGG00000016369.1)
  22. Mesocricetus auratus (Golden Hamster) miRNA (ENSMAUG00000005633.1)
  23. Microcebus murinus (gray mouse lemur) microRNA 214 (ENSMICG00000018168.3)
  24. Microtus ochrogaster (vole) microRNA 214 (ENSMOCG00000007654.1)
  25. Mus musculus microRNA mmu-mir-214 precursor
  26. Mus pahari (Shrew mouse) microRNA 214 (MGP_PahariEiJ_G0007514.1)
  27. Mus spicilegus (steppe mouse) microRNA 214 (ENSMSIG00000021358.1)
  28. Mus spretus microRNA 214 (MGP_SPRETEiJ_G0007323.1)
  29. Nannospalax galili microRNA 214 (ENSNGAG00000006294.1)
  30. Neotoma lepida microRNA mir-214
  31. Nomascus leucogenys microRNA 214 (ENSNLEG00000026352.2)
  32. Oryctolagus cuniculus (rabbit) microRNA 214 (ENSOCUG00000018870.1)
  33. Otolemur garnettii microRNA 214 (ENSOGAG00000019464.1)
  34. Pan troglodytes microRNA ptr-mir-214 precursor
  35. Papio anubis (olive baboon) microRNA 214 (ENSPANG00000003066.3)
  36. Peromyscus maniculatus bairdii microRNA 214 (ENSPEMG00000005711.2)
  37. Piliocolobus tephrosceles microRNA 214 (ENSPTEG00000015318.1)
  38. Pongo abelii microRNA 214 (ENSPPYG00000022170.2)
  39. Pongo pygmaeus microRNA ppy-mir-214 precursor
  40. Prolemur simus microRNA 214 (ENSPSMG00000008026.1)
  41. Propithecus coquereli microRNA 214 (ENSPCOG00000002689.1)
  42. Rattus norvegicus (Norway rat) microRNA 214 (ENSRNOG00000035513.3)
  43. Rhinopithecus bieti (Black snub-nosed monkey) microRNA 214 (ENSRBIG00000017276.1, ENSRBIG00000017301.1)
  44. Rhinopithecus roxellana microRNA 214 (ENSRROG00000012913.1)
  45. Saguinus labiatus microRNA sla-mir-214 precursor
  46. Saimiri boliviensis boliviensis microRNA 214 (ENSSBOG00000003247.1)
  47. Theropithecus gelada (gelada) microRNA 214 (ENSTGEG00000004931.1)
  48. Tupaia belangeri (northern tree shrew) microRNA 214 (ENSTBEG00000017903.1)
Publications