Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-214 precursor URS0000160683_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR214: MIR214 is a microRNA that has been reported to increase in the oxLDL-induced model, suggesting its potential role in endothelial injury [PMC9199460]. In addition to MIR214, miR-106 is another microRNA that has been found to increase in the same model [PMC9199460]. Inhibition of these molecules could potentially protect against endothelial injury [PMC9199460]. Furthermore, there are six gene-based genome-wide significant association signals at three novel genomic regions: 1q24.3 (DNM3OS, MIR214, and MIR3120), 9q22.32 (MIR23B and MIR27B), and 16p13.3 (LINC00921) [PMC5458088]. These regions are associated with various genetic factors that may play a role in different biological processes or diseases [PMC5458088]. Overall, understanding the functions and regulation of microRNAs like MIR214 can provide insights into their potential therapeutic applications in protecting against endothelial injury or other related conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 55 other species

  1. Aotus nancymaae microRNA 214 (ENSANAG00000009637.1)
  2. Ateles geoffroyi microRNA age-mir-214 precursor
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-mir-3120 (ENSCJAG00000030390.3)
  4. Carlito syrichta (Philippine tarsier) microRNA 214 (ENSTSYG00000022233.2)
  5. Castor canadensis (American beaver) miRNA (ENSCCNG00000016370.1)
  6. Cavia porcellus microRNA 214 (ENSCPOG00000016605.3)
  7. Cebus imitator (Panamanian white-faced capuchin) microRNA 214 (ENSCCAG00000012171.1)
  8. Cercocebus atys microRNA 214 (ENSCATG00000022725.1)
  9. Chlorocebus sabaeus (African green monkey) microRNA 214 (ENSCSAG00000026679.1)
  10. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000019218.1)
  11. Cricetulus griseus (Chinese hamster) microRNA mir-214 (ENSCGRG00000021251.1, ENSCGRG00001001342.1, ENSCGRG00015011417.2)
  12. Fukomys damarensis miRNA (ENSFDAG00000004387.1)
  13. Gorilla gorilla gorilla ggo-mir-214 (ENSGGOG00000032556.2)
  14. Gorilla gorilla microRNA ggo-mir-214 precursor
  15. Heterocephalus glaber (naked mole-rat) microRNA mir-214
  16. Macaca fascicularis (Crab-eating macaque) microRNA 214 (ENSMFAG00000020383.2)
  17. Macaca mulatta microRNA mml-mir-214 precursor
  18. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-214 precursor
  19. Mandrillus leucophaeus (Drill) microRNA 214 (ENSMLEG00000022217.1)
  20. Meriones unguiculatus miRNA (ENSMUGG00000016369.1)
  21. Mesocricetus auratus (Golden Hamster) miRNA (ENSMAUG00000005633.1)
  22. Microcebus murinus microRNA 214 (ENSMICG00000018168.3)
  23. Microtus ochrogaster (vole) microRNA 214 (ENSMOCG00000007654.1)
  24. Mus musculus microRNA mmu-mir-214 precursor
  25. Mus pahari (Shrew mouse) microRNA 214 (MGP_PahariEiJ_G0007514.1)
  26. Mus spicilegus (steppe mouse) microRNA 214 (ENSMSIG00000021358.1)
  27. Mus spretus microRNA 214 (MGP_SPRETEiJ_G0007323.1)
  28. Nannospalax galili microRNA 214 (ENSNGAG00000006294.1)
  29. Neotoma lepida microRNA mir-214
  30. Nomascus leucogenys microRNA 214 (ENSNLEG00000026352.2)
  31. Oryctolagus cuniculus microRNA 214 (ENSOCUG00000018870.1)
  32. Otolemur garnettii (small-eared galago) microRNA 214 (ENSOGAG00000019464.1)
  33. Pan paniscus microRNA ppa-mir-214 precursor
  34. Pan troglodytes microRNA ptr-mir-214 precursor
  35. Papio anubis (olive baboon) microRNA 214 (ENSPANG00000003066.3)
  36. Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 214 (ENSPEMG00000005711.2)
  37. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 214 (ENSPTEG00000015318.1)
  38. Pongo abelii microRNA 214 (ENSPPYG00000022170.2)
  39. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-214 precursor
  40. Prolemur simus microRNA 214 (ENSPSMG00000008026.1)
  41. Propithecus coquereli microRNA 214 (ENSPCOG00000002689.1)
  42. Rattus norvegicus (Norway rat) microRNA 214 (ENSRNOG00000035513.3)
  43. Rhinopithecus bieti microRNA 214 (ENSRBIG00000017276.1, ENSRBIG00000017301.1)
  44. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 214 (ENSRROG00000012913.1)
  45. Saguinus labiatus microRNA sla-mir-214 precursor
  46. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 214 (ENSSBOG00000003247.1)
  47. Theropithecus gelada microRNA 214 (ENSTGEG00000004931.1)
  48. Tupaia belangeri microRNA 214 (ENSTBEG00000017903.1)
Publications