Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-214 precursor URS0000160683_10090

Automated summary: This pre miRNA sequence is 110 nucleotides long and is found in Mus musculus. Annotated by 6 databases (RefSeq, miRBase, Ensembl, Ensembl/GENCODE, ENA, MGI). Described in 46 papers. Matches 1 Rfam family (mir-214, RF00660). Mus musculus (house mouse) microRNA mmu-mir-214 precursor sequence is a product of Mir214, mir-214, mir-214 precursor, mir-214 precurso, mmu-mir-214 precursor genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 45 other species

    1. Aotus nancymaae miRNA
    2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-214 precursor
    3. Callithrix jacchus cja-mir-3120
    4. Carlito syrichta (Philippine tarsier) miRNA
    5. Castor canadensis microRNA 214
    6. Cavia porcellus microRNA 214
    7. Cercocebus atys (Sooty mangabey) miRNA
    8. Chlorocebus sabaeus (African green monkey) miRNA
    9. Colobus angolensis palliatus microRNA 214
    10. Cricetulus griseus (Chinese hamster) microRNA 214
    11. Fukomys damarensis (Damara mole rat) miRNA
    12. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-214
    13. Gorilla gorilla microRNA ggo-mir-214 precursor
    14. Heterocephalus glaber microRNA 214
    15. Homo sapiens microRNA hsa-mir-214 precursor
    16. Macaca fascicularis miRNA
    17. Macaca mulatta microRNA mml-mir-214 precursor
    18. Macaca nemestrina microRNA mne-mir-214 precursor
    19. Mandrillus leucophaeus (Drill) miRNA
    20. Meriones unguiculatus miRNA
    21. Mesocricetus auratus (Golden Hamster) miRNA
    22. Microcebus murinus miRNA
    23. Microtus ochrogaster microRNA 214
    24. Mus pahari microRNA 214
    25. Mus spicilegus miRNA
    26. Mus spretus microRNA 214
    27. Nannospalax galili microRNA 214 (Mir214)
    28. Neotoma lepida microRNA mir-214
    29. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    30. Oryctolagus cuniculus (rabbit) microRNA 214
    31. Otolemur garnettii (small-eared galago) miRNA
    32. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-214 precursor
    33. Pan troglodytes (chimpanzee) microRNA ptr-mir-214 precursor
    34. Papio anubis (Olive baboon) miRNA
    35. Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 214
    36. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 214
    37. Pongo abelii microRNA 214
    38. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-214 precursor
    39. Prolemur simus microRNA 214
    40. Propithecus coquereli (Coquerel's sifaka) miRNA
    41. Rhinopithecus bieti miRNA
    42. Rhinopithecus roxellana microRNA 214
    43. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-214 precursor
    44. Saimiri boliviensis boliviensis miRNA
    45. Theropithecus gelada microRNA 214
    46. Tupaia belangeri microRNA 214