Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-99a-5p URS0000157026_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (LncBase, IntAct, MalaCards, RefSeq, miRBase, GeneCards, TarBase, PSICQUIC, ENA, MirGeneDB). Described in 76 papers. Homo sapiens (human) hsa-miR-99a-5p sequence is a product of hsa-miR-99a, hsa-miR-99a-5p, 99, MIR99A, miR-99a, miR-99a-5p, miR-99 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 16A, 2C18, 4F5, 90K, A-myb, ABRAXAS2, ABRO1, ACH, ACVRIP1, ADO.

Interactions 4

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-99a-5p interacts with:

Interaction id Participant Synonyms
EBI-25635039 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-25470128 intact:EBI-25470096 EBI-25470096 ENST00000340107 mrna_fgfr3
URS0000157026_9606-0 P08069 P08069
URS0000157026_9606-1 P08069 P08069

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACCCGUAGAUCCGAUCUUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 289 other species

    1. Alligator mississippiensis ami-miR-99a-5p
    2. Anolis carolinensis (green anole) aca-miR-99a-5p
    3. Bos taurus Bta-Mir-10-P2c_5p (mature (guide))
    4. Callorhinchus milii Cmi-Mir-10-P2c_5p (mature (guide))
    5. Canis lupus familiaris Cfa-Mir-10-P2c_5p (mature (guide))
    6. Capra hircus (goat) miR-99a
    7. Cavia porcellus (domestic guinea pig) cpo-miR-99a-5p
    8. Chrysemys picta bellii Cpi-Mir-10-P2c_5p (mature (guide))
    9. Chrysemys picta (Painted turtle) cpi-miR-99a-5p
    10. Columba livia cli-miR-99-5p
    11. Danio rerio dre-miR-99
    12. Dasypus novemcinctus dno-miR-99a-5p
    13. Echinops telfairi Ete-Mir-10-P2c_5p (mature (guide))
    14. Equus caballus (horse) eca-miR-99a
    15. Gadus morhua gmo-miR-99-5p
    16. Gallus gallus gga-miR-99a-5p
    17. Gekko japonicus Gja-Mir-10-P2c_5p (mature (guide))
    18. Gorilla gorilla (western gorilla) ggo-miR-99a
    19. Ictalurus punctatus (channel catfish) ipu-miR-99a
    20. Lagothrix lagotricha lla-miR-99a
    21. Latimeria chalumnae (coelacanth) Lch-Mir-10-P2c_5p (mature (guide))
    22. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P2c_5p (mature (guide))
    23. Macaca mulatta mml-miR-99a-5p
    24. Macaca nemestrina (pig-tailed macaque) mne-miR-99a
    25. Maylandia zebra (zebra mbuna) mze-miR-99b
    26. Microcaecilia unicolor Mun-Mir-10-P2c_5p (mature (guide))
    27. Microcebus murinus (gray mouse lemur) mmr-miR-99a
    28. Monopterus albus (swamp eel) Mal-Mir-10-P2c2_5p (mature (guide))
    29. Mus musculus mmu-miR-99a-5p
    30. Neolamprologus brichardi nbr-miR-99b
    31. Ophiophagus hannah oha-miR-99a-5p
    32. Oreochromis niloticus oni-miR-99b
    33. Ornithorhynchus anatinus Oan-Mir-10-P2c_5p (mature (guide))
    34. Oryctolagus cuniculus (rabbit) ocu-miR-99a-5p
    35. Ovis aries (sheep) miscellaneous RNA
    36. Pan paniscus ppa-miR-99a
    37. Pan troglodytes ptr-miR-99a
    38. Pongo pygmaeus ppy-miR-99a
    39. Pundamilia nyererei pny-miR-99b
    40. Python bivittatus (Burmese python) Pbv-Mir-10-P2c_5p (mature (guide))
    41. Rattus norvegicus (Norway rat) rno-miR-99a-5p
    42. Salmo salar (Atlantic salmon) ssa-miR-99-5p
    43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-10-P2c_5p (mature (guide))
    44. Scyliorhinus torazame (cloudy catshark) Sto-Mir-10-P2c_5p (mature (guide))
    45. Sphenodon punctatus (tuatara) Spt-Mir-10-P2c_5p (mature (guide))
    46. Sus scrofa ssc-miR-99a-5p
    47. Taeniopygia guttata Tgu-Mir-10-P2c_5p (mature (guide))
    48. Tor tambroides (Thai mahseer) miR-99
    49. Tupaia chinensis tch-miR-99a-5p
    50. Xenopus laevis Xla-Mir-10-P2c3_5p (mature (guide))
    51. Xenopus tropicalis xtr-miR-99
    Publications New