Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gadus morhua (Atlantic cod) gmo-miR-99-5p URS0000157026_8049

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCCGUAGAUCCGAUCUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis ami-miR-99a-5p
  2. Anolis carolinensis aca-miR-99a-5p
  3. Bos taurus (cattle) Bta-Mir-10-P2c_5p (mature (guide))
  4. Callorhinchus milii Cmi-Mir-10-P2c_5p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-10-P2c_5p (mature (guide))
  6. Capra hircus (goat) miR-99a
  7. Cavia porcellus (domestic guinea pig) cpo-miR-99a-5p
  8. Chrysemys picta bellii Cpi-Mir-10-P2c_5p (mature (guide))
  9. Chrysemys picta (Painted turtle) cpi-miR-99a-5p
  10. Columba livia cli-miR-99-5p
  11. Danio rerio dre-miR-99
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-99a-5p
  13. Echinops telfairi Ete-Mir-10-P2c_5p (mature (guide))
  14. Equus caballus (horse) eca-miR-99a
  15. Gallus gallus (chicken) gga-miR-99a-5p
  16. Gekko japonicus Gja-Mir-10-P2c_5p (mature (guide))
  17. Gorilla gorilla gorilla ggo-miR-99a (MIR99A)
  18. Gorilla gorilla (western gorilla) ggo-miR-99a
  19. Homo sapiens hsa-miR-99a-5p
  20. Ictalurus punctatus (channel catfish) ipu-miR-99a
  21. Lagothrix lagotricha (brown woolly monkey) lla-miR-99a
  22. Latimeria chalumnae (coelacanth) Lch-Mir-10-P2c_5p (mature (guide))
  23. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P2c_5p (mature (guide))
  24. Macaca mulatta mml-miR-99a-5p
  25. Macaca nemestrina mne-miR-99a
  26. Maylandia zebra (zebra mbuna) mze-miR-99b
  27. Microcaecilia unicolor Mun-Mir-10-P2c_5p (mature (guide))
  28. Microcebus murinus (gray mouse lemur) mmr-miR-99a
  29. Monopterus albus Mal-Mir-10-P2c2_5p (mature (guide))
  30. Mus musculus (house mouse) mmu-miR-99a-5p
  31. Neolamprologus brichardi (lyretail cichlid) nbr-miR-99b
  32. Ophiophagus hannah oha-miR-99a-5p
  33. Oreochromis niloticus (Nile tilapia) oni-miR-99b
  34. Ornithorhynchus anatinus Oan-Mir-10-P2c_5p (mature (guide))
  35. Oryctolagus cuniculus ocu-miR-99a-5p
  36. Ovis aries (sheep) miscellaneous RNA
  37. Pan paniscus ppa-miR-99a
  38. Pan troglodytes (chimpanzee) ptr-miR-99a
  39. Pongo pygmaeus ppy-miR-99a
  40. Pundamilia nyererei pny-miR-99b
  41. Python bivittatus (Burmese python) Pbv-Mir-10-P2c_5p (mature (guide))
  42. Rattus norvegicus (Norway rat) rno-miR-99a-5p
  43. Salmo salar (Atlantic salmon) ssa-miR-99-5p
  44. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-10-P2c_5p (mature (guide))
  45. Scyliorhinus torazame (cloudy catshark) Sto-Mir-10-P2c_5p (mature (guide))
  46. Sphenodon punctatus Spt-Mir-10-P2c_5p (mature (guide))
  47. Sus scrofa (pig) ssc-miR-99a-5p
  48. Taeniopygia guttata Tgu-Mir-10-P2c_5p (mature (guide))
  49. Tor tambroides miR-99
  50. Tupaia chinensis tch-miR-99a-5p
  51. Xenopus laevis (African clawed frog) Xla-Mir-10-P2c3_5p (mature (guide))
  52. Xenopus tropicalis (tropical clawed frog) xtr-miR-99