Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-99a-5p URS0000157026_9031

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCCGUAGAUCCGAUCUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 103 other species

  1. Alligator mississippiensis (American alligator) ami-miR-99a-5p
  2. Anolis carolinensis (green anole) aca-miR-99a-5p
  3. Bos taurus (cattle) Bta-Mir-10-P2c_5p (mature (guide))
  4. Callorhinchus milii Cmi-Mir-10-P2c_5p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-10-P2c_5p (mature (guide))
  6. Capra hircus (goat) miR-99a
  7. Cavia porcellus (domestic guinea pig) cpo-miR-99a-5p
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-10-P2c_5p (mature (guide))
  9. Chrysemys picta cpi-miR-99a-5p
  10. Columba livia (rock pigeon) cli-miR-99-5p
  11. Danio rerio (zebrafish) dre-miR-99
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-99a-5p
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P2c_5p (mature (guide))
  14. Equus caballus eca-miR-99a
  15. Gadus morhua (Atlantic cod) gmo-miR-99-5p
  16. Gekko japonicus Gja-Mir-10-P2c_5p (mature (guide))
  17. Gorilla gorilla gorilla ggo-miR-99a (MIR99A)
  18. Gorilla gorilla ggo-miR-99a
  19. Homo sapiens hsa-miR-99a-5p
  20. Ictalurus punctatus ipu-miR-99a
  21. Lagothrix lagotricha lla-miR-99a
  22. Latimeria chalumnae Lch-Mir-10-P2c_5p (mature (guide))
  23. Lepisosteus oculatus Loc-Mir-10-P2c_5p (mature (guide))
  24. Macaca mulatta (Rhesus monkey) mml-miR-99a-5p
  25. Macaca nemestrina (pig-tailed macaque) mne-miR-99a
  26. Maylandia zebra mze-miR-99b
  27. Microcaecilia unicolor Mun-Mir-10-P2c_5p (mature (guide))
  28. Microcebus murinus (gray mouse lemur) mmr-miR-99a
  29. Monopterus albus Mal-Mir-10-P2c2_5p (mature (guide))
  30. Mus musculus mmu-miR-99a-5p
  31. Neolamprologus brichardi nbr-miR-99b
  32. Ophiophagus hannah oha-miR-99a-5p
  33. Oreochromis niloticus (Nile tilapia) oni-miR-99b
  34. Ornithorhynchus anatinus (platypus) Oan-Mir-10-P2c_5p (mature (guide))
  35. Oryctolagus cuniculus (rabbit) ocu-miR-99a-5p
  36. Ovis aries miscellaneous RNA
  37. Pan paniscus (pygmy chimpanzee) ppa-miR-99a
  38. Pan troglodytes ptr-miR-99a
  39. Pongo pygmaeus ppy-miR-99a
  40. Pundamilia nyererei pny-miR-99b
  41. Python bivittatus (Burmese python) Pbv-Mir-10-P2c_5p (mature (guide))
  42. Rattus norvegicus rno-miR-99a-5p
  43. Salmo salar ssa-miR-99-5p
  44. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-10-P2c_5p (mature (guide))
  45. Scyliorhinus torazame Sto-Mir-10-P2c_5p (mature (guide))
  46. Sphenodon punctatus (tuatara) Spt-Mir-10-P2c_5p (mature (guide))
  47. Sus scrofa ssc-miR-99a-5p
  48. Taeniopygia guttata (zebra finch) Tgu-Mir-10-P2c_5p (mature (guide))
  49. Tor tambroides (Thai mahseer) miR-99
  50. Tupaia chinensis tch-miR-99a-5p
  51. Xenopus laevis Xla-Mir-10-P2c3_5p (mature (guide))
  52. Xenopus tropicalis (tropical clawed frog) xtr-miR-99
Publications