Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-99a-5p URS0000157026_10090

Automated summary: This piRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, miRBase, PirBase, ENA, TarBase, MirGeneDB, LncBase). Described in 27 papers. Mus musculus (house mouse) mmu-miR-99a-5p sequence is a product of Mir99a, miR-99a, miR-99a-5p, mmu-miR-99a-5p, mmu-miR-99a, miR-99 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610009E20Rik, 0610025L18Rik, 1110007A06Rik, 1300019I21Rik, 1700008E11Rik, 1700092A20Rik, 2210009N18Rik, 2210409B22Rik, 2310002F04Rik, 2310024H13Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACCCGUAGAUCCGAUCUUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Alligator mississippiensis ami-miR-99a-5p
    2. Anolis carolinensis aca-miR-99a-5p
    3. Bos taurus (cattle) Bta-Mir-10-P2c_5p (mature (guide))
    4. Callorhinchus milii eshark_mir-99_3
    5. Canis lupus familiaris (dog) Cfa-Mir-10-P2c_5p (mature (guide))
    6. Capra hircus miR-99a
    7. Cavia porcellus (domestic guinea pig) cpo-miR-99a-5p
    8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-10-P2c_5p (mature (guide))
    9. Chrysemys picta (Painted turtle) cpi-miR-99a-5p
    10. Columba livia cli-miR-99-5p
    11. Danio rerio (zebrafish) dre-miR-99
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-99a-5p
    13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P2c_5p (mature (guide))
    14. Equus caballus eca-miR-99a
    15. Gadus morhua (Atlantic cod) gmo-miR-99-5p
    16. Gallus gallus gga-miR-99a-5p
    17. Gorilla gorilla (western gorilla) ggo-miR-99a
    18. Homo sapiens (human) hsa-miR-99a-5p
    19. Ictalurus punctatus ipu-miR-99a
    20. Lagothrix lagotricha lla-miR-99a
    21. Macaca mulatta mml-miR-99a-5p
    22. Macaca nemestrina mne-miR-99a
    23. Maylandia zebra (zebra mbuna) mze-miR-99b
    24. Microcebus murinus mmr-miR-99a
    25. Neolamprologus brichardi nbr-miR-99b
    26. Ophiophagus hannah (king cobra) oha-miR-99a-5p
    27. Oreochromis niloticus (Nile tilapia) oni-miR-99b
    28. Ornithorhynchus anatinus (platypus) Oan-Mir-10-P2c_5p (mature (guide))
    29. Oryctolagus cuniculus ocu-miR-99a-5p
    30. Ovis aries miscellaneous RNA
    31. Pan paniscus (pygmy chimpanzee) ppa-miR-99a
    32. Pan troglodytes ptr-miR-99a
    33. Pongo pygmaeus (Bornean orangutan) ppy-miR-99a
    34. Pundamilia nyererei pny-miR-99b
    35. Rattus norvegicus rno-miR-99a-5p
    36. Salmo salar ssa-miR-99-5p
    37. Sarcophilus harrisii Sha-Mir-10-P2c_5p (mature (guide))
    38. Scyliorhinus torazame (cloudy catshark) Sto-Mir-10-P2c_5p (mature (guide))
    39. Sus scrofa (pig) ssc-miR-99a-5p
    40. Taeniopygia guttata Tgu-Mir-10-P2c3_5p (mature (guide))
    41. Tor tambroides miR-99
    42. Tupaia chinensis tch-miR-99a-5p
    43. Xenopus laevis (African clawed frog) xla-miR-99
    44. Xenopus tropicalis xtr-miR-99