Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cucumis melo (muskmelon) cme-miR398a URS0000155F38_3656

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGUUCUCAGGUCGCCCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Aquilegia coerulea aqc-miR398b
  2. Asparagus officinalis aof-miR398
  3. Brachypodium distachyon (stiff brome) bdi-miR398a
  4. Citrus sinensis (sweet orange) csi-miR398b-3p
  5. Cynara cardunculus cca-miR398
  6. Dimocarpus longan miR398b
  7. Glycine max (soybean) gma-miR398c
  8. Linum usitatissimum (flax) lus-miR398a
  9. Macrophomina phaseolina MS6 miR398a
  10. Malus domestica (apple) mdm-miR398c
  11. Manihot esculenta mes-miR398
  12. Medicago truncatula mtr-miR398c
  13. Nicotiana tabacum (common tobacco) nta-miR398
  14. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR398b
  15. Oryza sativa (rice) osa-miR398b
  16. Populus tomentosa Pto-miR398c-3p
  17. Populus trichocarpa (black cottonwood) ptc-miR398b
  18. Prunus persica (peach) ppe-miR398a-3p
  19. Ricinus communis (castor bean) rco-miR398b
  20. Theobroma cacao tcc-miR398a
  21. Vitis vinifera vvi-miR398c
Publications