Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR398b URS0000155F38_4530

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGUUCUCAGGUCGCCCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR398b
  2. Asparagus officinalis (garden asparagus) aof-miR398
  3. Brachypodium distachyon (stiff brome) bdi-miR398a
  4. Citrus sinensis (sweet orange) csi-miR398b-3p
  5. Cucumis melo cme-miR398a
  6. Cynara cardunculus (wild artichoke) cca-miR398
  7. Dimocarpus longan miR398b
  8. Glycine max gma-miR398d
  9. Linum usitatissimum (flax) lus-miR398a
  10. Macrophomina phaseolina MS6 miR398a
  11. Malus domestica (apple) mdm-miR398b
  12. Manihot esculenta mes-miR398
  13. Medicago truncatula mtr-miR398b
  14. Nicotiana tabacum nta-miR398
  15. Oryza sativa Japonica Group microRNA osa-miR398b
  16. Populus tomentosa Pto-miR398c-3p
  17. Populus trichocarpa ptc-miR398c-3p
  18. Prunus persica (peach) ppe-miR398a-3p
  19. Ricinus communis (castor bean) rco-miR398b
  20. Theobroma cacao tcc-miR398a
  21. Vitis vinifera vvi-miR398c
Publications