Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-192-5p URS0000155642_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (RefSeq, MalaCards, MirGeneDB, TarBase, GeneCards, LncBase, ENA, miRBase). Described in 64 papers. Homo sapiens (human) hsa-miR-192-5p sequence is a product of hsa-miR-192-5p, hsa-miR-192, MIR192, miR-192-5p, miR-192 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 16E1BP, 1700010H15RiK, 19A, 239FB, 3-PAP, 30K, 30ST3B1, 3D3, 3OST3B1, 3PAP.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUGACCUAUGAAUUGACAGCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 19 other species

    1. Bos taurus (cattle) Bta-Mir-192-P1_5p (mature (guide))
    2. Canis lupus familiaris (dog) cfa-miR-192
    3. Capra hircus chi-miR-192-5p
    4. Cavia porcellus (domestic guinea pig) cpo-miR-192-5p
    5. Cervus elaphus cel-miR-192
    6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-192-P1_5p (mature (guide))
    7. Equus caballus eca-miR-192
    8. Gorilla gorilla (western gorilla) ggo-miR-192
    9. Macaca mulatta mml-miR-192-5p
    10. Mus musculus mmu-miR-192-5p
    11. Nomascus leucogenys nle-miR-192
    12. Ornithorhynchus anatinus (platypus) oan-miR-192-5p
    13. Otolemur garnettii oga-miR-192
    14. Pan paniscus (pygmy chimpanzee) ppa-miR-192
    15. Pan troglodytes ptr-miR-192
    16. Pongo pygmaeus (Bornean orangutan) ppy-miR-192
    17. Rattus norvegicus rno-miR-192-5p
    18. Sarcophilus harrisii Sha-Mir-192-P1_5p (mature (guide))
    19. Sus scrofa (pig) ssc-miR-192
    20. Tupaia chinensis tch-miR-192-5p