Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-192-5p URS0000155642_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-192: Hsa-mir-192 is a microRNA that has been associated with nonalcoholic liver diseases [PMC7936154]. Exosomes derived from hepatocytes treated with palmitic acid showed significantly higher levels of hsa-mir-192, along with other microRNAs such as hsa-miR-24, has-miR-19b, hsa-miR-34a, and hsa-miR-122 [PMC7936154]. These microRNAs have been previously linked to nonalcoholic liver diseases [PMC7936154]. Hsa-mir-192 is one of the microRNAs that displayed the highest connectivity and regulated 25 targets [PMC5620483]. Hsa-miR-26b, hsa-mir-192, hsa-miR-21, hsa-miR-181a, and hsa-miR-155 were found to regulate 43, 25, 26, 15 and 11 targets respectively [PMC5620483]. These findings suggest that these microRNAs may play a significant role in the regulation of various cellular processes in hepatocytes. The upregulation of these specific microRNAs in exosomes derived from palmitic acid-treated hepatocytes may have implications for the development and progression of nonalcoholic liver diseases. Further research is needed to fully understand the functional significance of these findings and their potential as therapeutic targets for liver diseases.

mRNA interactions 7 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGACCUAUGAAUUGACAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus Bta-Mir-192-P2_5p (mature (guide))
  2. Canis lupus familiaris cfa-miR-192
  3. Capra hircus chi-miR-192-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-192-5p
  5. Cervus elaphus cel-miR-192
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-192-P2_5p (mature (guide))
  7. Equus caballus (horse) eca-miR-192
  8. Gorilla gorilla gorilla ggo-miR-192 (MIR192)
  9. Gorilla gorilla ggo-miR-192
  10. Macaca mulatta (Rhesus monkey) mml-miR-192-5p
  11. Mus musculus (house mouse) mmu-miR-192-5p
  12. Nomascus leucogenys nle-miR-192
  13. Ornithorhynchus anatinus oan-miR-192-5p
  14. Oryctolagus cuniculus Ocu-Mir-192-P2_5p (mature (guide))
  15. Otolemur garnettii oga-miR-192
  16. Pan paniscus ppa-miR-192
  17. Pan troglodytes (chimpanzee) ptr-miR-192
  18. Pongo pygmaeus (Bornean orangutan) ppy-miR-192
  19. Rattus norvegicus (Norway rat) rno-miR-192-5p
  20. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-192-P2_5p (mature (guide))
  21. Sus scrofa (pig) ssc-miR-192
  22. Tupaia chinensis tch-miR-192-5p
Publications