Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-192-5p URS0000155642_10116

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Rattus norvegicus. Annotated by 3 databases (miRBase, RefSeq, MirGeneDB). Rattus norvegicus (Norway rat) rno-miR-192-5p sequence is a product of miR-192, rno-miR-192-5p, rno-miR-192, miR-192-5p, Mir192 genes. Found in the Rattus norvegicus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CUGACCUAUGAAUUGACAGCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 21 other species

    1. Bos taurus (cattle) Bta-Mir-192-P2_5p (mature (guide))
    2. Canis lupus familiaris cfa-miR-192
    3. Capra hircus (goat) chi-miR-192-5p
    4. Cavia porcellus cpo-miR-192-5p
    5. Cervus elaphus cel-miR-192
    6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-192-P2_5p (mature (guide))
    7. Equus caballus (horse) eca-miR-192
    8. Gorilla gorilla ggo-miR-192
    9. Homo sapiens (human) hsa-miR-192-5p
    10. Macaca mulatta mml-miR-192-5p
    11. Mus musculus (house mouse) mmu-miR-192-5p
    12. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-192
    13. Ornithorhynchus anatinus oan-miR-192-5p
    14. Oryctolagus cuniculus Ocu-Mir-192-P2_5p (mature (guide))
    15. Otolemur garnettii oga-miR-192
    16. Pan paniscus ppa-miR-192
    17. Pan troglodytes (chimpanzee) ptr-miR-192
    18. Pongo pygmaeus (Bornean orangutan) ppy-miR-192
    19. Sarcophilus harrisii Sha-Mir-192-P2_5p (mature (guide))
    20. Sus scrofa ssc-miR-192
    21. Tupaia chinensis (Chinese tree shrew) tch-miR-192-5p
    Publications