Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-222-5p URS0000153377_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-222: Hsa-mir-222, a microRNA, was found to be associated with poor prognosis in EBV+DLBCL patients, with a study revealing two distinct subpopulations based on its expression levels [PMC4322989]. Specifically, patients with elevated levels of hsa-mir-222 were predominantly non-GCB subtype and were determined to have the worst prognosis according to the Salles algorithm [PMC4322989]. Furthermore, a high percentage of these patients were in advanced stages of the disease (Ann Arbor stage III or IV) and had an International Prognostic Index (IPI) greater than 2, indicating a more aggressive disease course [PMC4322989]. Despite various clinical features associated with poor outcomes being prevalent in this group, only the correlation with Salles classification reached statistical significance [PMC4322989].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCAGUAGCCAGUGUAGAUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications