Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-29b precursor (hsa-mir-29b-1) URS0000150A7D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR29B1: MIR29B1 is a microRNA that has been observed to be downregulated in Alzheimer's disease (AD) patients [PMC7564652]. It has been found to target secretases, which are involved in AD pathogenesis, as well as have a protective effect on neuron survival [PMC7564652]. Additionally, MIR29B1 has been shown to regulate BACE1 expression, a gene involved in AD, in vitro [PMC7564652]. In the cortex of AD patients, MIR29B1 is downregulated along with other microRNAs such as MIR129-2, MIR1296, MIR219A1, MIR375, MIR411, and MIR431 [PMC7564652]. Conversely, microRNAs such as MIR199A2 and MIR92A1 are upregulated in the cortex of AD patients [PMC7564652]. In other contexts, such as dairy cattle domestication and breast cancer cells (MDA-MB-231S), upregulation of MIR29B1 has been observed [PMC6898964] [PMC4651668]. It is also a host gene for miR-22 and miR-29b which are downregulated in certain diseases like SMZL (splenic marginal zone lymphoma) [PMC7111612] [PMC8064455]. In rats with a homozygous mutation of the Mir29b-1/a gene that encodes nucleotides 6–9 in the sequence of mature miR-29b-3p (MIR29B1), reduced urine volume and urinary sodium excretion were observed due to reduced NO levels in the renal outer medulla [PMC6156712].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000014030.1)
  2. Ateles geoffroyi microRNA age-mir-29b precursor
  3. Bos taurus microRNA bta-mir-29b precursor (bta-mir-29b-1)
  4. Capra hircus (Goat) microRNA 29b-1 (ENSCHIG00000009164.1)
  5. Carlito syrichta miRNA (ENSTSYG00000026059.1)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA 29b-1 (ENSCCAG00000002159.1)
  7. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000008809.1)
  8. Chlorocebus sabaeus (African green monkey) microRNA 29b-1 (ENSCSAG00000027654.1)
  9. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000005717.1)
  10. Equus caballus (horse) microRNA eca-mir-29b precursor
  11. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-29b-1 (ENSGGOG00000034324.2)
  12. Gorilla gorilla microRNA ggo-mir-29b precursor (ggo-mir-29b-1)
  13. Lagothrix lagotricha microRNA lla-mir-29b precursor
  14. Loxodonta africana (African savanna elephant) microRNA 29b-1 (ENSLAFG00000024071.1)
  15. Macaca mulatta (Rhesus monkey) microRNA mml-mir-29b precursor (mml-mir-29b-1)
  16. Macaca nemestrina miRNA (ENSMNEG00000007424.1)
  17. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000002577.1)
  18. Microcebus murinus microRNA 29b-1 (ENSMICG00000018084.3)
  19. Nomascus leucogenys microRNA 29b-1 (ENSNLEG00000022424.2)
  20. Otolemur garnettii miRNA (ENSOGAG00000020823.1)
  21. Ovis aries miRNA (ENSOARG00000022267.1)
  22. Pan paniscus microRNA ppa-mir-29b precursor (ppa-mir-29b-1)
  23. Panthera pardus microRNA 29b-1 (ENSPPRG00000014477.1)
  24. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000001757.1)
  25. Pan troglodytes (chimpanzee) microRNA ptr-mir-29b precursor (ptr-mir-29b-1)
  26. Pongo abelii miRNA
  27. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-29b precursor (ppy-mir-29b-1)
  28. Propithecus coquereli miRNA (ENSPCOG00000009588.1)
  29. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000027791.1)
  30. Rhinopithecus bieti miRNA (ENSRBIG00000009855.1)
  31. Rhinopithecus roxellana miRNA (ENSRROG00000006154.1)
  32. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000010900.1)
Publications