Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 29b-1 (ENSNLEG00000022424.2) URS0000150A7D_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000014030.1)
  2. Ateles geoffroyi microRNA age-mir-29b precursor
  3. Bos taurus microRNA bta-mir-29b precursor (bta-mir-29b-1)
  4. Capra hircus (Goat) microRNA 29b-1 (ENSCHIG00000009164.1)
  5. Carlito syrichta miRNA (ENSTSYG00000026059.1)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA 29b-1 (ENSCCAG00000002159.1)
  7. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000008809.1)
  8. Chlorocebus sabaeus (African green monkey) microRNA 29b-1 (ENSCSAG00000027654.1)
  9. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000005717.1)
  10. Equus caballus (horse) microRNA eca-mir-29b precursor
  11. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-29b-1 (ENSGGOG00000034324.2)
  12. Gorilla gorilla microRNA ggo-mir-29b precursor (ggo-mir-29b-1)
  13. Homo sapiens (human) microRNA hsa-mir-29b precursor (hsa-mir-29b-1)
  14. Lagothrix lagotricha microRNA lla-mir-29b precursor
  15. Loxodonta africana (African savanna elephant) microRNA 29b-1 (ENSLAFG00000024071.1)
  16. Macaca mulatta (Rhesus monkey) microRNA mml-mir-29b precursor (mml-mir-29b-1)
  17. Macaca nemestrina miRNA (ENSMNEG00000007424.1)
  18. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000002577.1)
  19. Microcebus murinus microRNA 29b-1 (ENSMICG00000018084.3)
  20. Otolemur garnettii miRNA (ENSOGAG00000020823.1)
  21. Ovis aries miRNA (ENSOARG00000022267.1)
  22. Pan paniscus microRNA ppa-mir-29b precursor (ppa-mir-29b-1)
  23. Panthera pardus microRNA 29b-1 (ENSPPRG00000014477.1)
  24. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000001757.1)
  25. Pan troglodytes (chimpanzee) microRNA ptr-mir-29b precursor (ptr-mir-29b-1)
  26. Pongo abelii miRNA
  27. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-29b precursor (ppy-mir-29b-1)
  28. Propithecus coquereli miRNA (ENSPCOG00000009588.1)
  29. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000027791.1)
  30. Rhinopithecus bieti miRNA (ENSRBIG00000009855.1)
  31. Rhinopithecus roxellana miRNA (ENSRROG00000006154.1)
  32. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000010900.1)
Publications