v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-200b-3p URS000014D9C1_7955

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAAUACUGCCUGGUAAUGAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Anolis carolinensis (green anole) aca-miR-200b-3p
  2. Callorhinchus milii eshark_mir-8_1
  3. Capra hircus (goat) chi-miR-200b
  4. Ciona savignyi (Pacific transparent sea squirt) csa-miR-200
  5. Cyprinus carpio (common carp) ccr-miR-200b
  6. Equus caballus (horse) eca-miR-200b
  7. Homo sapiens hsa-miR-200b-3p
  8. Macaca fascicularis (crab-eating macaque) microRNA miR-200b-3p
  9. Monodelphis domestica (gray short-tailed opossum) mdo-miR-200b-3p
  10. Mus musculus (house mouse) mmu-miR-200b-3p
  11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63138
  12. Takifugu rubripes (torafugu) fru-miR-200b
  13. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-200b
  14. Tor tambroides (Thai mahseer) miR-200b-3p
  15. Tupaia chinensis (Chinese tree shrew) tch-miR-200b-3p
 Publications