Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-196a precursor (hsa-mir-196a-1) URS000014C145_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR196A1: MIR196A1 is a member of the MIR196 gene family, which includes MIR196A1, MIR196A2, and MIR196B. It is a noncoding RNA derived from the HOXB gene cluster on chromosome 17 in humans. [PMC4413621]. Studies have identified MIR196A1 as a potential biomarker for several diseases, including hepatocellular carcinoma, leukemia, lung cancer, breast cancer, colorectal cancer, and pancreatic adenocarcinoma [PMC10134363]. The expression of MIR196A1 can be influenced by genetic variations and is correlated with HOXB7 and HOXB8 expression [PMC5551414]. It has also been associated with adipogenesis and body fat distribution [PMC5551414]. The miR-196 family includes miR-196a-2 (encoded by MIR196A2) and miR-196b (encoded by MIR196B), which share identical seed sequences with miR-196a1 [PMC6080909]. Aberrant methylation of the CpG sites in the RUNX3 and MIR196A1 genes has been observed in relation to smoking cessation [PMC5960087]. Additionally, the combination of VAT1L, CALR, LINC01456, RP11-484L8.1, MIR148A, and MIR 19 6 A 1 has been associated with overall survival in pancreatic cancer patients [PMC5641173]. Overall,MIR19 6 A 1 plays a role in various diseases as a potential biomarker or regulator of gene expression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAAUUAGGUAGUUUCAUGUUGUUGGGCCUGGGUUUCUGAACACAACAACAUUAAACCACCCGAUUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

Publications