Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-93-5p URS0000149452_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (IntAct, MirGeneDB, LncBase, miRBase, PSICQUIC, MalaCards, ENA, TarBase, RefSeq, GeneCards). Described in 86 papers. Homo sapiens (human) hsa-miR-93-5p sequence is a product of hsa-miR-93, hsa-miR-93-5p, MIR93, miR-93, miR-93-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 14-3-3-zeta, 1700010H15RiK, 182-FIP, 2'-PDE, 20D7-FC4, 2700066J21Rik, 3-10C, 3635, 3D3.

Interactions 28

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-93-5p interacts with:

Interaction id Participant Synonyms
EBI-25296116 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-22055571 intact:EBI-21019594 EBI-21019594 ENST00000405375 mrna_cdkn1a
URS0000149452_9606-14 O95477 O95477
URS0000149452_9606-0 O95477 O95477
URS0000149452_9606-1 P01130 P01130
URS0000149452_9606-15 P01130 P01130
URS0000149452_9606-2 P08254 P08254
URS0000149452_9606-16 P08254 P08254
URS0000149452_9606-5 P10145 P10145
URS0000149452_9606-3 P10145 P10145
URS0000149452_9606-4 P10145 P10145
URS0000149452_9606-17 P10145 P10145
URS0000149452_9606-18 P10145 P10145
URS0000149452_9606-6 P13726 P13726
URS0000149452_9606-19 P13726 P13726
URS0000149452_9606-20 P15692 P15692
URS0000149452_9606-21 P15692 P15692
URS0000149452_9606-8 P15692 P15692
URS0000149452_9606-9 P15692 P15692
URS0000149452_9606-7 P15692 P15692
URS0000149452_9606-10 P38936 P38936
URS0000149452_9606-22 P38936 P38936
URS0000149452_9606-23 Q92736 Q92736
URS0000149452_9606-11 Q92736 Q92736
URS0000149452_9606-12 Q92831 Q92831
URS0000149452_9606-24 Q92831 Q92831
URS0000149452_9606-25 Q9BYX2 Q9BYX2
URS0000149452_9606-13 Q9BYX2 Q9BYX2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAAAGUGCUGUUCGUGCAGGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 44 other species

    1. Alligator mississippiensis ami-miR-93-5p
    2. Bos taurus (cattle) Bta-Mir-17-P1c_5p (mature (guide))
    3. Callithrix jacchus cja-miR-93
    4. Canis lupus familiaris cfa-miR-93
    5. Capra hircus chi-miR-93-5p
    6. Cavia porcellus (domestic guinea pig) cpo-miR-93-5p
    7. Cervus elaphus (red deer) cel-miR-93
    8. Chrysemys picta bellii Cpi-Mir-17-P1c_5p (mature (guide))
    9. Cricetulus griseus cgr-miR-93-5p
    10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-93-5p
    11. Daubentonia madagascariensis (aye-aye) dma-miR-93
    12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-17-P1c_5p (mature (guide))
    13. Equus caballus (horse) eca-miR-93
    14. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-56021
    15. Macaca mulatta Mml-Mir-17-P1c_5p (mature (guide))
    16. Monodelphis domestica Mdo-Mir-17-P1c_5p (mature (guide))
    17. Mus musculus (house mouse) mmu-miR-93-5p
    18. Nomascus leucogenys nle-miR-93
    19. Oryctolagus cuniculus (rabbit) ocu-miR-93-5p
    20. Otolemur garnettii oga-miR-93
    21. Papio hamadryas (hamadryas baboon) pha-miR-93
    22. Pteropus alecto pal-miR-93-5p
    23. Rattus norvegicus rno-miR-93-5p
    24. Sarcophilus harrisii Sha-Mir-17-P1c_5p (mature (guide))
    25. Sus scrofa ssc-mir1
    26. Tupaia chinensis tch-miR-93-5p
    27. Tursiops truncatus miR-93
    28. Xenopus laevis (African clawed frog) xla-miR-93-5p
    29. Xenopus tropicalis Xtr-Mir-17-P1c_5p (mature (guide))