Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-93-5p URS0000149452_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-17: Hsa-mir-17 is an induced miRNA expressed as a cluster, with up to 33-fold induction confirmed using quantitative RT-PCR [PMC3836776]. The expression profiles of most hsa-mir-17 target genes are negatively correlated with the expression profile of hsa-mir-17, as shown in Figure 4(b) [PMC3995724]. In a network analysis, MYC was predicted to regulate several miRNAs, including miR-378, hsa-mir-17, hsa-miR-19a, hsa-miR-19b, hsa-miR-20b, hsa-miR-92, hsa-miR-106a, hsa-miR-25, hsa-miR-106b, and hsa-miR-125b [PMC3483236].

mRNA interactions 13 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGUGCUGUUCGUGCAGGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 57 other species

  1. Alligator mississippiensis ami-miR-93-5p
  2. Bos taurus Bta-Mir-17-P4d_5p (mature (guide))
  3. Callithrix jacchus cja-miR-93
  4. Canis lupus familiaris cfa-miR-93
  5. Capra hircus chi-miR-93-5p
  6. Cavia porcellus (domestic guinea pig) cpo-miR-93-5p
  7. Cervus elaphus cel-miR-93
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-17-P4d_5p (mature (guide))
  9. Cricetulus griseus (Chinese hamster) cgr-miR-93-5p
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-93-5p
  11. Daubentonia madagascariensis (aye-aye) dma-miR-93
  12. Echinops telfairi Ete-Mir-17-P4d_5p (mature (guide))
  13. Equus caballus eca-miR-93
  14. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-56021
  15. Macaca mulatta (Rhesus monkey) Mml-Mir-17-P4d_5p (mature (guide))
  16. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-17-P4d_5p (mature (guide))
  17. Mus musculus (house mouse) mmu-miR-93-5p
  18. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-93
  19. Oryctolagus cuniculus ocu-miR-93-5p
  20. Otolemur garnettii (small-eared galago) oga-miR-93
  21. Papio hamadryas pha-miR-93
  22. Pteropus alecto (black flying fox) pal-miR-93-5p
  23. Rattus norvegicus rno-miR-93-5p
  24. Sarcophilus harrisii Sha-Mir-17-P4d_5p (mature (guide))
  25. Sus scrofa ssc-mir1
  26. Tupaia chinensis (Chinese tree shrew) tch-miR-93-5p
  27. Tursiops truncatus miR-93
  28. Xenopus laevis xla-miR-93-5p
  29. Xenopus tropicalis Xtr-Mir-17-P4d_5p (mature (guide))
Publications