Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U4 small nuclear 2 (RNU4-2) secondary structure diagram

Homo sapiens (human) RNA, U4 small nuclear 2 (RNU4-2) URS0000149178_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNU4-2: RNU4-2 is a member of the small nuclear U4 RNA family and is involved in pre-mRNA intron splicing regulation [PMC9803687]. In ilBC samples, RNU4-2 was found to be upregulated compared to benign breast tissue [PMC9803687]. Higher levels of RNU4-2 have also been associated with poorer prognosis in colon cancer tissue [PMC9803687]. The levels of RNU4-2 were measured after treating cells with ActD to observe changes in Prx1-associated snRNAs and mRNAs at the post-transcriptional level [PMC6690714]. RNU4-2 is one of the major snRNAs, along with U5, encoded by the RNU4-2 and RNU5D-1 genes [PMC9881141]. No information about RNU4-2 in breast or other cancers was found in PubMed or the NURSA Transcriptomine database [PMC5966448]. Deletion of a single T-run from an RNU4-2 reporter plasmid caused an enhancement of read-through, suggesting a functional role for such elements in termination [PMC7610016]. In COAD patients, RNU4-2 was identified as one of the core genes associated with initial lymphatic metastasis and potential biomarkers for COAD [PMC9444393]. The expression of mRNA differed between COAD tissues and RNU4-2 [PMC9444393]. Additionally, RNU4-2 is involved in RNA processing related to suicide and autism [PMC9444393]. Overall, these findings highlight the importance of studying the role and expression levels of RNU4-2 in various diseases [PMC9803687, PMC6690714, PMC9881141, PMC5966448, PMC7610016, PMC9444393].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUUUGCGCAGUGGCAGUAUCGUAGCCAAUGAGGUUUAUCCGAGGCGCGAUUAUUGCUAAUUGAAAACUUUUCCCAAUACCCCGCCAUGACGACUUGAAAUAUAGUCGGCAUUGGCAAUUUUUGACAGUCUCUACGGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 91 other species

  1. Ailuropoda melanoleuca U4 spliceosomal RNA (ENSAMEG00000027461.1)
  2. Aotus nancymaae U4 spliceosomal RNA (ENSANAG00000003754.1)
  3. Balaenoptera musculus (Blue whale) U4 spliceosomal RNA (ENSBMSG00010009247.1)
  4. Callithrix jacchus U4 spliceosomal RNA (ENSCJAG00000080088.1)
  5. Camelus dromedarius (Arabian camel) U4 spliceosomal RNA (ENSCDRG00005018216.1)
  6. Camelus ferus (Wild Bactrian camel) U4 spliceosomal RNA
  7. Canis lupus dingo U4 spliceosomal RNA (ENSCAFG00020020568.1)
  8. Canis lupus familiaris U4 spliceosomal RNA (ENSCAFG00000059403.1, ENSCAFG00030023857.1, ENSCAFG00040019816.1, ENSCAFG00845029640.1)
  9. Capra hircus (Goat) U4 spliceosomal RNA (ENSCHIG00000000778.1)
  10. Castor canadensis (American beaver) U4 spliceosomal RNA (ENSCCNG00000019160.1)
  11. Catagonus wagneri (Chacoan peccary) U4 spliceosomal RNA (ENSCWAG00000014415.1)
  12. Cavia porcellus U4 spliceosomal RNA (ENSCPOG00000031308.1)
  13. Cebus imitator U4 spliceosomal RNA (ENSCCAG00000005140.1)
  14. Cercocebus atys (Sooty mangabey) U4 spliceosomal RNA (ENSCATG00000005075.1)
  15. Cervus hanglu yarkandensis (Yarkand deer) U4 spliceosomal RNA (ENSCHYG00000003014.1)
  16. Chlorocebus sabaeus U4 spliceosomal RNA (ENSCSAG00000027279.1)
  17. Colobus angolensis palliatus U4 spliceosomal RNA (ENSCANG00000015989.1)
  18. Cricetulus griseus U4 spliceosomal RNA (ENSCGRG00001003865.1, ENSCGRG00015037903.1)
  19. Delphinapterus leucas U4 spliceosomal RNA (ENSDLEG00000017876.1)
  20. Erinaceus europaeus (western European hedgehog) U4 spliceosomal RNA (ENSEEUG00000016307.1, ENSEEUG00000017001.1)
  21. Felis catus U4 spliceosomal RNA (ENSFCAG00000042780.1)
  22. Fukomys damarensis (Damara mole rat) U4 spliceosomal RNA (ENSFDAG00000003218.1)
  23. Gorilla gorilla gorilla (Western Lowland Gorilla) U4 spliceosomal RNA (ENSGGOG00000037864.1)
  24. Heterocephalus glaber (naked mole-rat) U4 spliceosomal RNA (ENSHGLG00000032033.1, ENSHGLG00000032227.1, ENSHGLG00100046822.1, ENSHGLG00100051441.1)
  25. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) U4 spliceosomal RNA (ENSSTOG00000029029.1)
  26. Laticauda laticaudata (blue-ringed sea krait) U4 spliceosomal RNA (ENSLLTG00000000244.1)
  27. Lynx canadensis (Canada lynx) U4 spliceosomal RNA (ENSLCNG00005020385.1)
  28. Macaca fascicularis (Crab-eating macaque) U4 spliceosomal RNA (ENSMFAG00000064901.1)
  29. Macaca mulatta U4 spliceosomal RNA (ENSMMUG00000049453.1)
  30. Macaca nemestrina U4 spliceosomal RNA (ENSMNEG00000011112.1)
  31. Mandrillus leucophaeus U4 spliceosomal RNA (ENSMLEG00000010786.1)
  32. Marmota marmota marmota U4 spliceosomal RNA (ENSMMMG00000021130.1)
  33. Marmota monax (woodchuck) non-coding RNA
  34. Microcebus murinus U4 spliceosomal RNA
  35. Microtus ochrogaster U4 spliceosomal RNA (ENSMOCG00000009401.1)
  36. Monodelphis domestica (gray short-tailed opossum) U4 spliceosomal RNA (ENSMODG00000041301.1)
  37. Monodon monoceros U4 spliceosomal RNA (ENSMMNG00015011319.1)
  38. Moschus moschiferus (Siberian musk deer) U4 spliceosomal RNA (ENSMMSG00000014199.1)
  39. Mus caroli (Ryukyu mouse) U4 spliceosomal RNA (MGP_CAROLIEiJ_G0035390.1)
  40. Mus musculus (mouse) predicted gene, 24407 (ENSMUSG00000119132.1)
  41. Mus spicilegus (steppe mouse) U4 spliceosomal RNA (ENSMSIG00000011105.1)
  42. Mus spretus predicted gene, 24407 (MGP_SPRETEiJ_G0036290.1)
  43. Mustela putorius furo U4 spliceosomal RNA (ENSMPUG00000021298.1)
  44. Naja naja (Indian cobra) U4 spliceosomal RNA (ENSNNAG00000018568.1)
  45. Nannospalax galili U4 spliceosomal RNA (ENSNGAG00000010487.1)
  46. Neotoma lepida U4 spliceosomal RNA
  47. Neogale vison (American mink) U4 spliceosomal RNA (ENSNVIG00000009574.1)
  48. Notechis scutatus (mainland tiger snake) U4 spliceosomal RNA (ENSNSUG00000000827.1)
  49. Octodon degus U4 spliceosomal RNA (ENSODEG00000025764.1)
  50. Ophiophagus hannah U4 spliceosomal RNA
  51. Ornithorhynchus anatinus U4 spliceosomal RNA (ENSOANG00000048221.1)
  52. Otolemur garnettii U4 spliceosomal RNA (ENSOGAG00000020605.2)
  53. Ovis aries (sheep) U4 spliceosomal RNA (ENSOARG00020013351.2, ENSOARG00020035138.1)
  54. Pan paniscus (bonobo) U4 spliceosomal RNA (ENSPPAG00000000048.1)
  55. Panthera leo U4 spliceosomal RNA (ENSPLOG00000009256.1)
  56. Panthera pardus (leopard) U4 spliceosomal RNA (ENSPPRG00000022327.1)
  57. Panthera tigris altaica (Tiger) U4 spliceosomal RNA (ENSPTIG00000002169.1)
  58. Pan troglodytes U4 spliceosomal RNA (ENSPTRG00000045043.1)
  59. Papio anubis U4 spliceosomal RNA (ENSPANG00000051005.1)
  60. Peromyscus maniculatus bairdii U4 spliceosomal RNA (ENSPEMG00000030892.1)
  61. Phascolarctos cinereus U4 spliceosomal RNA (ENSPCIG00000035217.1)
  62. Phocoena sinus U4 spliceosomal RNA (ENSPSNG00000006947.1)
  63. Physeter catodon (sperm whale) U4 spliceosomal RNA (ENSPCTG00005019938.1)
  64. Piliocolobus tephrosceles (Ugandan red Colobus) U4 spliceosomal RNA (ENSPTEG00000000865.1, ENSPTEG00000039046.1)
  65. Pongo abelii U4 spliceosomal RNA (ENSPPYG00000031748.1)
  66. Prolemur simus U4 spliceosomal RNA (ENSPSMG00000001528.1)
  67. Propithecus coquereli (Coquerel's sifaka) U4 spliceosomal RNA (ENSPCOG00000012199.1)
  68. Pseudonaja textilis U4 spliceosomal RNA (ENSPTXG00000016043.1, ENSPTXG00000016044.1)
  69. Pteropus alecto U4 spliceosomal RNA
  70. Pteropus vampyrus U4 spliceosomal RNA (ENSPVAG00000025328.1)
  71. Rattus norvegicus U4 spliceosomal RNA (ENSRNOG00000069182.1)
  72. Rhinolophus ferrumequinum (greater horseshoe bat) U4 spliceosomal RNA (ENSRFEG00010014680.1)
  73. Rhinopithecus bieti U4 spliceosomal RNA (ENSRBIG00000007917.1)
  74. Rhinopithecus roxellana (Golden snub-nosed monkey) U4 spliceosomal RNA (ENSRROG00000001636.1)
  75. Saimiri boliviensis boliviensis U4 spliceosomal RNA (ENSSBOG00000015134.1)
  76. Salvator merianae (Argentine black and white tegu) U4 spliceosomal RNA (ENSSMRG00000016565.1)
  77. Sarcophilus harrisii U4 spliceosomal RNA (ENSSHAG00000024405.1)
  78. Sciurus vulgaris U4 spliceosomal RNA (ENSSVLG00005008110.1)
  79. Sorex araneus U4 spliceosomal RNA (ENSSARG00000015064.1)
  80. Suricata suricatta (meerkat) U4 spliceosomal RNA (ENSSSUG00005015010.1)
  81. Sus scrofa U4 spliceosomal RNA (multiple genes)
  82. Theropithecus gelada (gelada) U4 spliceosomal RNA (ENSTGEG00000022972.1)
  83. Tursiops truncatus U4 spliceosomal RNA (ENSTTRG00000021516.1, ENSTTRG00000021623.1)
  84. Urocitellus parryii U4 spliceosomal RNA (ENSUPAG00010017085.1)
  85. Ursus americanus U4 spliceosomal RNA (ENSUAMG00000019306.1)
  86. Ursus maritimus (Polar bear) U4 spliceosomal RNA (ENSUMAG00000006217.1)
  87. Ursus thibetanus thibetanus U4 spliceosomal RNA (ENSUTTG00000006360.1)
  88. Vicugna pacos (alpaca) U4 spliceosomal RNA (ENSVPAG00000017059.1)
  89. Vombatus ursinus U4 spliceosomal RNA (ENSVURG00010006619.1)
  90. Vulpes vulpes U4 spliceosomal RNA (ENSVVUG00000020986.1)
  91. Zalophus californianus (california sea lion) U4 spliceosomal RNA (ENSZCAG00015020097.1)
2D structure Publications