Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U4 small nuclear 2 (RNU4-2) secondary structure diagram

Homo sapiens (human) RNA, U4 small nuclear 2 (RNU4-2) URS0000149178_9606

Automated summary: This snRNA sequence is 141 nucleotides long and is found in Homo sapiens. Annotated by 5 databases (GeneCards, RefSeq, Ensembl, HGNC, Rfam). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (U4, RF00015). Homo sapiens (human) RNA, U4 small nuclear 2 (RNU4-2) sequence is a product of RNU4-2, ENSG00000202538.1 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGCUUUGCGCAGUGGCAGUAUCGUAGCCAAUGAGGUUUAUCCGAGGCGCGAUUAUUGCUAAUUGAAAACUUUUCCCAAUACCCCGCCAUGACGACUUGAAAUAUAGUCGGCAUUGGCAAUUUUUGACAGUCUCUACGGAGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 90 other species

    1. Ailuropoda melanoleuca U4 spliceosomal RNA (ENSAMEG00000027461.1)
    2. Aotus nancymaae (Ma's night monkey) U4 spliceosomal RNA (ENSANAG00000003754.1)
    3. Balaenoptera musculus (Blue whale) U4 spliceosomal RNA (ENSBMSG00010009247.1)
    4. Callithrix jacchus U4 spliceosomal RNA (ENSCJAG00000080088.1)
    5. Camelus dromedarius U4 spliceosomal RNA (ENSCDRG00005018216.1)
    6. Camelus ferus U4 spliceosomal RNA
    7. Canis lupus dingo (dingo) U4 spliceosomal RNA (ENSCAFG00020020568.1)
    8. Canis lupus familiaris U4 spliceosomal RNA (ENSCAFG00000059403.1, ENSCAFG00030023857.1, ENSCAFG00040019816.1, ENSCAFG00845029640.1)
    9. Capra hircus (Goat) U4 spliceosomal RNA (ENSCHIG00000000778.1)
    10. Castor canadensis U4 spliceosomal RNA (ENSCCNG00000019160.1)
    11. Catagonus wagneri (Chacoan peccary) U4 spliceosomal RNA (ENSCWAG00000014415.1)
    12. Cavia porcellus U4 spliceosomal RNA (ENSCPOG00000031308.1)
    13. Cercocebus atys (Sooty mangabey) U4 spliceosomal RNA (ENSCATG00000005075.1)
    14. Cervus hanglu yarkandensis U4 spliceosomal RNA (ENSCHYG00000003014.1)
    15. Chlorocebus sabaeus U4 spliceosomal RNA (ENSCSAG00000027279.1)
    16. Colobus angolensis palliatus U4 spliceosomal RNA (ENSCANG00000015989.1)
    17. Cricetulus griseus U4 spliceosomal RNA (ENSCGRG00001003865.1, ENSCGRG00015004321.1)
    18. Delphinapterus leucas U4 spliceosomal RNA (ENSDLEG00000017876.1)
    19. Erinaceus europaeus U4 spliceosomal RNA (ENSEEUG00000016307.1, ENSEEUG00000017001.1)
    20. Felis catus U4 spliceosomal RNA (ENSFCAG00000042780.1)
    21. Fukomys damarensis U4 spliceosomal RNA (ENSFDAG00000003218.1)
    22. Gorilla gorilla gorilla U4 spliceosomal RNA (ENSGGOG00000037864.1)
    23. Heterocephalus glaber U4 spliceosomal RNA (ENSHGLG00000024817.1, ENSHGLG00100024522.1)
    24. Ictidomys tridecemlineatus U4 spliceosomal RNA (ENSSTOG00000029029.1)
    25. Laticauda laticaudata (blue-ringed sea krait) U4 spliceosomal RNA (ENSLLTG00000000244.1)
    26. Lynx canadensis U4 spliceosomal RNA (ENSLCNG00005020385.1)
    27. Macaca fascicularis U4 spliceosomal RNA (ENSMFAG00000064901.1)
    28. Macaca mulatta (Macaque) U4 spliceosomal RNA (ENSMMUG00000049453.1)
    29. Macaca nemestrina U4 spliceosomal RNA (ENSMNEG00000011112.1)
    30. Mandrillus leucophaeus U4 spliceosomal RNA (ENSMLEG00000010786.1)
    31. Marmota marmota marmota (Alpine marmot) U4 spliceosomal RNA (ENSMMMG00000021130.1)
    32. Marmota monax (woodchuck) non-coding RNA
    33. Microcebus murinus (gray mouse lemur) U4 spliceosomal RNA
    34. Microtus ochrogaster (vole) U4 spliceosomal RNA (ENSMOCG00000009401.1)
    35. Monodelphis domestica U4 spliceosomal RNA (ENSMODG00000041301.1)
    36. Monodon monoceros U4 spliceosomal RNA (ENSMMNG00015011319.1)
    37. Moschus moschiferus U4 spliceosomal RNA (ENSMMSG00000014199.1)
    38. Mus caroli U4 spliceosomal RNA (MGP_CAROLIEiJ_G0035390.1)
    39. Mus musculus predicted gene, 24407 (ENSMUSG00000119132.1)
    40. Mus spicilegus U4 spliceosomal RNA (ENSMSIG00000011105.1)
    41. Mus spretus (algerian mouse) predicted gene, 24407 (MGP_SPRETEiJ_G0036290.1)
    42. Mustela putorius furo U4 spliceosomal RNA (ENSMPUG00000021298.1)
    43. Naja naja (Indian cobra) U4 spliceosomal RNA (ENSNNAG00000018568.1)
    44. Nannospalax galili (Upper Galilee mountains blind mole rat) U4 spliceosomal RNA (ENSNGAG00000010487.1)
    45. Neotoma lepida U4 spliceosomal RNA
    46. Neogale vison (American mink) U4 spliceosomal RNA (ENSNVIG00000009574.1)
    47. Notechis scutatus U4 spliceosomal RNA (ENSNSUG00000000827.1)
    48. Octodon degus U4 spliceosomal RNA (ENSODEG00000025764.1)
    49. Ophiophagus hannah (king cobra) U4 spliceosomal RNA
    50. Ornithorhynchus anatinus U4 spliceosomal RNA (ENSOANG00000048221.1)
    51. Otolemur garnettii U4 spliceosomal RNA (ENSOGAG00000020605.2)
    52. Ovis aries (sheep) U4 spliceosomal RNA (ENSOARG00020013351.1, ENSOARG00020021838.1)
    53. Pan paniscus (bonobo) U4 spliceosomal RNA (ENSPPAG00000000048.1)
    54. Panthera leo (lion) U4 spliceosomal RNA (ENSPLOG00000009256.1)
    55. Panthera pardus U4 spliceosomal RNA (ENSPPRG00000022327.1)
    56. Panthera tigris altaica (Tiger) U4 spliceosomal RNA (ENSPTIG00000002169.1)
    57. Pan troglodytes (chimpanzee) U4 spliceosomal RNA (ENSPTRG00000045043.1)
    58. Papio anubis U4 spliceosomal RNA (ENSPANG00000051005.1)
    59. Peromyscus maniculatus bairdii (Northern American deer mouse) U4 spliceosomal RNA (ENSPEMG00000030892.1)
    60. Phascolarctos cinereus U4 spliceosomal RNA (ENSPCIG00000035217.1)
    61. Phocoena sinus (vaquita) U4 spliceosomal RNA (ENSPSNG00000006947.1)
    62. Physeter catodon (sperm whale) U4 spliceosomal RNA (ENSPCTG00005019938.1)
    63. Piliocolobus tephrosceles (Ugandan red Colobus) U4 spliceosomal RNA (ENSPTEG00000000865.1, ENSPTEG00000039046.1)
    64. Pongo abelii (Sumatran orangutan) U4 spliceosomal RNA (ENSPPYG00000031748.1)
    65. Prolemur simus U4 spliceosomal RNA (ENSPSMG00000001528.1)
    66. Propithecus coquereli (Coquerel's sifaka) U4 spliceosomal RNA (ENSPCOG00000012199.1)
    67. Pseudonaja textilis U4 spliceosomal RNA (ENSPTXG00000016043.1, ENSPTXG00000016044.1)
    68. Pteropus alecto (black flying fox) U4 spliceosomal RNA
    69. Pteropus vampyrus U4 spliceosomal RNA (ENSPVAG00000025328.1)
    70. Rattus norvegicus U4 spliceosomal RNA (ENSRNOG00000069182.1)
    71. Rhinolophus ferrumequinum (greater horseshoe bat) U4 spliceosomal RNA (ENSRFEG00010014680.1)
    72. Rhinopithecus bieti (Black snub-nosed monkey) U4 spliceosomal RNA (ENSRBIG00000007917.1)
    73. Rhinopithecus roxellana U4 spliceosomal RNA (ENSRROG00000001636.1)
    74. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) U4 spliceosomal RNA (ENSSBOG00000015134.1)
    75. Salvator merianae U4 spliceosomal RNA (ENSSMRG00000016565.1)
    76. Sarcophilus harrisii U4 spliceosomal RNA (ENSSHAG00000024405.1)
    77. Sciurus vulgaris (Eurasian red squirrel) U4 spliceosomal RNA (ENSSVLG00005008110.1)
    78. Sorex araneus U4 spliceosomal RNA (ENSSARG00000015064.1)
    79. Suricata suricatta (meerkat) U4 spliceosomal RNA (ENSSSUG00005015010.1)
    80. Sus scrofa U4 spliceosomal RNA (multiple genes)
    81. Theropithecus gelada U4 spliceosomal RNA (ENSTGEG00000022972.1)
    82. Tursiops truncatus U4 spliceosomal RNA (ENSTTRG00000021516.1, ENSTTRG00000021623.1)
    83. Urocitellus parryii (Arctic ground squirrel) U4 spliceosomal RNA (ENSUPAG00010017085.1)
    84. Ursus americanus U4 spliceosomal RNA (ENSUAMG00000019306.1)
    85. Ursus maritimus (Polar bear) U4 spliceosomal RNA (ENSUMAG00000006217.1)
    86. Ursus thibetanus thibetanus (Asiatic black bear) U4 spliceosomal RNA (ENSUTTG00000006360.1)
    87. Vicugna pacos U4 spliceosomal RNA (ENSVPAG00000017059.1)
    88. Vombatus ursinus U4 spliceosomal RNA (ENSVURG00010006619.1)
    89. Vulpes vulpes (red fox) U4 spliceosomal RNA (ENSVVUG00000020986.1)
    90. Zalophus californianus U4 spliceosomal RNA (ENSZCAG00015020097.1)
    2D structure Publications New