Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) ribonuclease P RNA component H1 secondary structure diagram

Homo sapiens (human) ribonuclease P RNA component H1 URS000013F331_9606

  • 341 nucleotides
  • 6 databases (GeneCards, HGNC, LNCipedia, MalaCards, PDBe, RefSeq)
  • Found in 1 species
  • RNase P RNA

Automated summary: This RNase P RNA sequence is 341 nucleotides long and is found in Homo sapiens. Annotated by 6 databases (LNCipedia, HGNC, PDBe, RefSeq, GeneCards, MalaCards). Described in 11 papers. Has a conserved secondary structure or a structured region. Has an experimentally determined 3D structure. Matches 1 Rfam family (RNaseP_nuc, RF00009). Homo sapiens (human) ribonuclease P RNA component H1 sequence is a product of RPPH1, lnc-CCNB1IP1-1 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUAGGGCGGAGGGAAGCUCAUCAGUGGGGCCACGAGCUGAGUGCGUCCUGUCACUCCACUCCCAUGUCCCUUGGGAAGGUCUGAGACUAGGGCCAGAGGCGGCCCUAACAGGGCUCUCCCUGAGCUUCGGGGAGGUGAGUUCCCAGAGAACGGGGCUCCGCGCGAGGUCAGACUGGGCAGGAGAUGCCGUGGACCCCGCCCUUCGGGGAGGGGCCCGGCGGAUGCCUCCUUUGCCGGAGCUUGGAACAGACUCACGGCCAGCGAAGUGAGUUCAAUGGCUGAGGUGAGGUACCCCGCAGGGGACCUCAUAACCCAAUUCAGACUACUCUCCUCCGCCCAUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    2D structure New