Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Gly (anticodon GCC) 2-1 (TRG-GCC2 1 to 6) secondary structure diagram

Homo sapiens (human) tRNA-Gly (anticodon GCC) 2-1 (TRG-GCC2 1 to 6) URS000013B42D_9606

Automated summary: This tRNA sequence is 71 nucleotides long and is found in Homo sapiens. Annotated by 5 databases (HGNC, ENA, Rfam, GeneCards, GtRNAdb). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Homo sapiens (human) tRNA-Gly (anticodon GCC) 2-1 (TRG-GCC2 1 to 6) sequence is a product of TRG-GCC2-3, TRG-GCC2-6, TRG-GCC2-2, tRNA-Gly-GCC-2-3, tRNA-Gly, tRNA-Gly-GCC-2-4, TRGL1, tRNA-Gly-GCC-2-6, TRG-GCC2-5, tRNA-Gly-GCC-2-2, TRG-GCC2-1, TRG-GCC2-4, tRNA-Gly-GCC-2-5, tRNA-Gly-GCC-2-1 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GCAUUGGUGGUUCAGUGGUAGAAUUCUCGCCUGCCACGCGGGAGGCCCGGGUUCGAUUCCCGGCCAAUGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 149 other species

    1. Acanthisitta chloris tRNA
    2. Ailuropoda melanoleuca tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    3. Alligator mississippiensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
    4. Alligator sinensis (Chinese alligator) tRNA
    5. Alosa alosa tRNA-Gly
    6. Amazona aestiva (blue-fronted amazon) tRNA
    7. Ameiurus melas (black bullhead) tRNA-Gly
    8. Anas platyrhynchos tRNA
    9. Anguilla anguilla tRNA-Gly
    10. Anolis carolinensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
    11. Apaloderma vittatum tRNA
    12. Aptenodytes forsteri (emperor penguin) tRNA
    13. Astyanax mexicanus tRNA
    14. Balaenoptera acutorostrata scammoni tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    15. Balearica regulorum gibbericeps tRNA
    16. Bos taurus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    17. Buceros rhinoceros silvestris tRNA
    18. Callipepla squamata tRNA
    19. Callithrix jacchus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 6)
    20. Callorhinchus milii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
    21. Calypte anna (Anna's hummingbird) tRNA
    22. Camelus ferus tRNA
    23. Canis lupus familiaris tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    24. Antrostomus carolinensis tRNA
    25. Cariama cristata (red-legged seriema) tRNA
    26. Carlito syrichta tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    27. Cathartes aura tRNA
    28. Cavia porcellus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
    29. Ceratotherium simum simum tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    30. Chaetura pelagica tRNA
    31. Charadrius vociferus tRNA
    32. Chelonia mydas (green seaturtle) tRNA
    33. Chelydra serpentina (Common snapping turtle) tRNA-Gly
    34. Chlamydotis macqueenii tRNA
    35. Chlorocebus sabaeus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
    36. Choloepus hoffmanni tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
    37. Chrysemys picta bellii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    38. Colinus virginianus tRNA
    39. Colius striatus (speckled mousebird) tRNA
    40. Columba livia tRNA
    41. Cricetulus griseus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
    42. Cuculus canorus tRNA
    43. Danionella translucida tRNA-Gly
    44. Danio rerio tRNA-Gly (GCC) (tRNA-Gly-GCC-3 1 to 12)
    45. Dasypus novemcinctus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    46. Dipodomys ordii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    47. Echinops telfairi tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    48. Egretta garzetta tRNA
    49. Equus caballus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
    50. Erinaceus europaeus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
    51. Eurypyga helias (sunbittern) tRNA
    52. Felis catus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 12)
    53. Ficedula albicollis tRNA
    54. Fukomys damarensis (Damara mole-rat) tRNA
    55. Fulmarus glacialis (northern fulmar) tRNA
    56. Gadus morhua tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
    57. Gallus gallus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5, tRNA-Gly-GCC-1-7)
    58. Gasterosteus aculeatus (three-spined stickleback) tRNA
    59. Geospiza fortis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    60. Gorilla gorilla gorilla tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 5)
    61. Haliaeetus albicilla tRNA
    62. Heterocephalus glaber tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    63. Hippoglossus stenolepis (Pacific halibut) tRNA-Gly
    64. Ictidomys tridecemlineatus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
    65. Lamprotornis superbus tRNA-OTHER
    66. Larimichthys crocea tRNA
    67. Latimeria chalumnae tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
    68. Lepisosteus oculatus (spotted gar) tRNA
    69. Leptosomus discolor tRNA
    70. Lonchura striata domestica (Bengalese finch) tRNA
    71. Loxodonta africana tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    72. Macaca mulatta tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 8)
    73. Manacus vitellinus (golden-collared manakin) tRNA
    74. Marmota monax (woodchuck) tRNA.Gly
    75. Megalops atlanticus (tarpon) tRNA-Gly
    76. Meleagris gallopavo tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
    77. Melopsittacus undulatus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
    78. Merops nubicus tRNA
    79. Mesitornis unicolor (brown roatelo) tRNA
    80. Mesocricetus auratus (golden hamster) tRNA
    81. Microcebus murinus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
    82. Monodelphis domestica tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    83. Mus caroli tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
    84. Mus musculus castaneus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
    85. Mus musculus domesticus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
    86. Mus musculus musculus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    87. Mus musculus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9, tRNA-Gly-GCC-2 1 to 8)
    88. Mus pahari tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
    89. Mus spretus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
    90. Mustela putorius furo tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
    91. Myotis brandtii tRNA
    92. Myotis davidii tRNA
    93. Myotis lucifugus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    94. Neotoma lepida tRNA
    95. Nestor notabilis tRNA
    96. Nipponia nippon (crested ibis) tRNA
    97. Nomascus leucogenys tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 6)
    98. Notamacropus eugenii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
    99. Nothobranchius furzeri tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
    100. Ochotona princeps tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    101. Ophiophagus hannah (king cobra) tRNA
    102. Opisthocomus hoazin tRNA
    103. Oreochromis niloticus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    104. Ornithorhynchus anatinus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 17)
    105. Oryctolagus cuniculus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    106. Oryzias latipes tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    107. Otolemur garnettii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
    108. Ovis aries tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    109. Pangasianodon hypophthalmus tRNA-Gly
    110. Pan troglodytes tRNA-Gly (GCC) (tRNA-Gly-GCC-2 2 to 6)
    111. Papio anubis tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 7)
    112. Paramuricea clavata tRNA.Gly
    113. Patagioenas fasciata monilis tRNA
    114. Pelecanus crispus tRNA
    115. Pelodiscus sinensis tRNA
    116. Perca flavescens tRNA-Gly
    117. Perca fluviatilis (European perch) tRNA-Gly
    118. Petromyzon marinus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    119. Phaethon lepturus tRNA
    120. Phalacrocorax carbo tRNA
    121. Phoenicopterus ruber ruber tRNA
    122. Dryobates pubescens tRNA
    123. Podiceps cristatus (great crested grebe) tRNA
    124. Poecilia formosa tRNA
    125. Pongo abelii tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 6)
    126. Procavia capensis tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 5)
    127. Pterocles gutturalis tRNA
    128. Pteropus alecto (black flying fox) tRNA
    129. Pygoscelis adeliae tRNA
    130. Rattus norvegicus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    131. Saimiri boliviensis boliviensis tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 7)
    132. Salmo salar tRNA
    133. Sarcophilus harrisii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
    134. Scleropages formosus tRNA
    135. Sorex araneus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    136. Struthio camelus australis tRNA
    137. Sus scrofa tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    138. Taeniopygia guttata tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
    139. Takifugu rubripes tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
    140. Tauraco erythrolophus tRNA
    141. Tetraodon nigroviridis tRNA
    142. Tinamus guttatus tRNA
    143. Trichechus manatus latirostris tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
    144. Tupaia chinensis tRNA
    145. Tursiops truncatus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    146. Vicugna pacos tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
    147. Xenopus laevis (African clawed frog) tRNA
    148. Xenopus tropicalis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 95)
    149. Xiphophorus maculatus (southern platyfish) tRNA
    2D structure Publications New