Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pteropus alecto (black flying fox) tRNA secondary structure diagram

Pteropus alecto (black flying fox) tRNA URS000013B42D_9402

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAUUGGUGGUUCAGUGGUAGAAUUCUCGCCUGCCACGCGGGAGGCCCGGGUUCGAUUCCCGGCCAAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 170 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  3. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  4. Albula goreensis tRNA-Gly
  5. Alligator mississippiensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
  6. Alligator sinensis tRNA
  7. Alosa alosa tRNA-Gly
  8. Amazona aestiva tRNA
  9. Ameiurus melas tRNA-Gly
  10. Anas platyrhynchos tRNA
  11. Anguilla anguilla (European eel) tRNA-Gly
  12. Anolis carolinensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
  13. Apaloderma vittatum tRNA
  14. Aptenodytes forsteri tRNA
  15. Astyanax mexicanus (Mexican tetra) tRNA
  16. Ataeniobius toweri tRNA-Gly
  17. Balaenoptera acutorostrata scammoni tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  18. Balearica regulorum gibbericeps tRNA
  19. Bos taurus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  20. Buceros rhinoceros silvestris tRNA
  21. Callipepla squamata (scaled quail) tRNA
  22. Callithrix jacchus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 6)
  23. Callorhinchus milii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
  24. Calypte anna tRNA
  25. Camelus ferus (Wild Bactrian camel) tRNA
  26. Canis lupus familiaris tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  27. Antrostomus carolinensis tRNA
  28. Cariama cristata tRNA
  29. Carlito syrichta tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  30. Cathartes aura (turkey vulture) tRNA
  31. Cavia porcellus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
  32. Ceratotherium simum simum tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  33. Chaetura pelagica (chimney swift) tRNA
  34. Characodon lateralis tRNA-Gly
  35. Charadrius vociferus tRNA
  36. Chelonia mydas tRNA
  37. Chelydra serpentina (Common snapping turtle) tRNA-Gly
  38. Chlamydotis macqueenii tRNA
  39. Chlorocebus sabaeus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  40. Choloepus hoffmanni tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  41. Chrysemys picta bellii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  42. Colinus virginianus tRNA
  43. Colius striatus (speckled mousebird) tRNA
  44. Columba livia tRNA
  45. Crenichthys baileyi tRNA-Gly
  46. Cricetulus griseus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
  47. Cuculus canorus (common cuckoo) tRNA
  48. Dallia pectoralis tRNA-Gly
  49. Danionella translucida tRNA-Gly
  50. Danio rerio tRNA-Gly (GCC) (tRNA-Gly-GCC-3 1 to 12)
  51. Dasypus novemcinctus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  52. Dendronephthya gigantea (Carnation coral) tRNA-Gly
  53. Dipodomys ordii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  54. Echinops telfairi tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  55. Egretta garzetta tRNA
  56. Eptesicus nilssonii tRNA-Gly
  57. Equus caballus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
  58. Erinaceus europaeus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
  59. Eurypyga helias tRNA
  60. Felis catus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 12)
  61. Ficedula albicollis tRNA
  62. Fukomys damarensis tRNA
  63. Fulmarus glacialis (northern fulmar) tRNA
  64. Gadus morhua tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
  65. Gallus gallus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5, tRNA-Gly-GCC-1-7)
  66. Gasterosteus aculeatus (three-spined stickleback) tRNA
  67. Geospiza fortis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  68. Gorilla gorilla gorilla tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 5)
  69. Haliaeetus albicilla tRNA
  70. Heterocephalus glaber tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  71. Hippoglossus stenolepis tRNA-Gly
  72. Homo sapiens tRNA-Gly (anticodon GCC) 2-1 (TRG-GCC2 1 to 6)
  73. Hyalella azteca tRNA-Gly
  74. Ictidomys tridecemlineatus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
  75. Lamprotornis superbus tRNA-OTHER
  76. Larimichthys crocea tRNA
  77. Latimeria chalumnae tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
  78. Lepisosteus oculatus tRNA
  79. Leptosomus discolor tRNA
  80. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015025896.1
  81. Lonchura striata domestica (Bengalese finch) tRNA
  82. Loxodonta africana tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  83. Lytechinus variegatus (Green sea urchin) tRNA-Gly
  84. Macaca mulatta tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 8)
  85. Manacus vitellinus tRNA
  86. Marmota monax (woodchuck) tRNA.Gly
  87. Megalops atlanticus (tarpon) tRNA-Gly
  88. Meleagris gallopavo tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
  89. Melopsittacus undulatus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 4)
  90. Merluccius polli tRNA-Gly
  91. Merops nubicus tRNA
  92. Mesitornis unicolor tRNA
  93. Mesocricetus auratus (golden hamster) tRNA
  94. Microcebus murinus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
  95. Monodelphis domestica tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  96. Mus caroli tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
  97. Mus musculus castaneus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
  98. Mus musculus domesticus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
  99. Mus musculus musculus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  100. Mus musculus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9, tRNA-Gly-GCC-2 1 to 8)
  101. Mus pahari tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
  102. Mus spretus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
  103. Mustela putorius furo tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
  104. Myotis brandtii tRNA
  105. Myotis davidii tRNA
  106. Myotis lucifugus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  107. Neotoma lepida (desert woodrat) tRNA
  108. Nestor notabilis tRNA
  109. Nipponia nippon tRNA
  110. Nomascus leucogenys tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 6)
  111. Notamacropus eugenii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
  112. Nothobranchius furzeri tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  113. Ochotona princeps tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  114. Ophiophagus hannah tRNA
  115. Opisthocomus hoazin tRNA
  116. Oreochromis niloticus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  117. Ornithorhynchus anatinus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 17)
  118. Oryctolagus cuniculus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  119. Oryzias latipes tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  120. Otolemur garnettii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
  121. Ovis aries tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  122. Pangasianodon gigas tRNA-Gly
  123. Pangasianodon hypophthalmus tRNA-Gly
  124. Pangasius djambal tRNA-Gly
  125. Pan troglodytes tRNA-Gly (GCC) (tRNA-Gly-GCC-2 2 to 6)
  126. Papio anubis tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 7)
  127. Paramuricea clavata tRNA.Gly
  128. Patagioenas fasciata monilis tRNA
  129. Pelecanus crispus tRNA
  130. Pelobates cultripes (western spadefoot toad) tRNA.Gly
  131. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  132. Perca flavescens tRNA-Gly
  133. Perca fluviatilis tRNA-Gly
  134. Petromyzon marinus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  135. Phaethon lepturus tRNA
  136. Phalacrocorax carbo (great cormorant) tRNA
  137. Phoenicopterus ruber ruber tRNA
  138. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  139. Dryobates pubescens tRNA
  140. Pleuronectes platessa (European plaice) tRNA-Gly
  141. Podarcis lilfordi tRNA.Gly
  142. Podiceps cristatus (great crested grebe) tRNA
  143. Poecilia formosa tRNA
  144. Pongo abelii tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 6)
  145. Portunus trituberculatus tRNA-Gly
  146. Procavia capensis tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 5)
  147. Pterocles gutturalis tRNA
  148. Pygoscelis adeliae (Adelie penguin) tRNA
  149. Rattus norvegicus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  150. Saccoglossus kowalevskii (Acorn worm) tRNA-Gly
  151. Saimiri boliviensis boliviensis tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 7)
  152. Salmo salar tRNA
  153. Sarcophilus harrisii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
  154. Scleropages formosus (Asian bonytongue) tRNA
  155. Sorex araneus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  156. Sphaerodactylus townsendi tRNA-Gly
  157. Struthio camelus australis tRNA
  158. Sus scrofa tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  159. Taeniopygia guttata tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
  160. Takifugu rubripes tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
  161. Tauraco erythrolophus (red-crested turaco) tRNA
  162. Tetraodon nigroviridis tRNA
  163. Tinamus guttatus tRNA
  164. Trichechus manatus latirostris tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
  165. Tupaia chinensis tRNA
  166. Tursiops truncatus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
  167. Vicugna pacos tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
  168. Xenopus laevis (African clawed frog) tRNA
  169. Xenopus tropicalis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 95)
  170. Xiphophorus maculatus (southern platyfish) tRNA
2D structure Publications