Equus caballus (horse) eca-miR-346 URS0000134ADC_9796

• 23 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 22 other species
• 30 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGUCUGCCCGCAUGCCUGCCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

1. Bos taurus (cattle) bta-miR-346
2. Canis lupus familiaris (dog) cfa-miR-346
3. Capra hircus chi-miR-346-5p
4. Cavia porcellus cpo-miR-346-5p
5. Homo sapiens (human) hsa-miR-346
6. Macaca mulatta (Rhesus monkey) mml-miR-346
7. Oryctolagus cuniculus ocu-miR-346-5p
8. Pan troglodytes (chimpanzee) ptr-miR-346
9. Pongo pygmaeus ppy-miR-346
10. Pteropus alecto (black flying fox) pal-miR-346-5p
11. Sus scrofa (pig) ssc-mir165

Publications Download

• FASTA
• JSON