Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-346 URS0000134ADC_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-346: Bta-mir-346 is a microRNA that is not detected at day 3 but increased at day 7 of the estrous cycle [PMC4156418]. It is one of the miRNAs that showed differential expression during the estrous cycle, with two upregulated miRNAs (bta-miR-374b, bta-miR-2887) and two downregulated miRNAs (bta-miR-147, bta-mir-346) consistently observed [PMC8568169]. Interestingly, bta-mir-346 was significantly found in subclinical stages before clinical signs appeared [PMC8568169]. Additionally, a human homolog of bta-mir-346 has been identified as a potential biomarker for tuberculosis and M. avium complex pulmonary disease caused by Mycobacterium species [PMC8568169]. Bta-mir-346 has the longest region of consecutive polymorphisms among microRNAs, with six out of seven nucleotides in its seed region being polymorphic [PMC4379384]. Overall, these findings suggest that bta-mir-346 plays a role in the regulation of gene expression during the estrous cycle and may have potential implications in disease biomarker research.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCUGCCCGCAUGCCUGCCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Canis lupus familiaris (dog) cfa-miR-346
  2. Capra hircus chi-miR-346-5p
  3. Cavia porcellus cpo-miR-346-5p
  4. Equus caballus (horse) eca-miR-346
  5. Homo sapiens (human) hsa-miR-346
  6. Macaca mulatta mml-miR-346
  7. Oryctolagus cuniculus (rabbit) ocu-miR-346-5p
  8. Pan troglodytes (chimpanzee) ptr-miR-346
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-346
  10. Pteropus alecto pal-miR-346-5p
  11. Sus scrofa (pig) ssc-mir165
Publications