Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-346 URS0000134ADC_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-346: Cfa-mir-346, a microRNA, is induced in canine macrophage-like cells upon infection with live parasites, specifically Leishmania spp [PMC9235276]. The induction of cfa-mir-346 in these cells is not associated with the induction of the endoplasmic reticulum (ER) stress marker sXBP1 [PMC9235276]. In dogs, cfa-mir-346 has been found to be upregulated in cardiac hypertrophy [PMC9235276] [PMC8542680]. The upregulation of cfa-mir-346 was observed in a canine macrophage-like cell line (DH82) infected with Leishmania spp, regardless of the strain or time point tested [PMC9235276]. The induction of cfa-mir-346 was not observed in response to ER stress induction with tunicamycin [PMC9235276]. Cfa-mir-346 is located within the glutamate ionotropic receptor delta type subunit 1 (GRID1) gene [PMC9235276]. In clinical samples, an increase in cfa-mir-346 expression levels was detected in the plasma of dogs infected with Leishmania spp, suggesting its potential as a non-invasive marker of infection [PMC9235276]. However, further studies are needed to understand its role during Leishmania infection and evaluate its specificity as a biomarker for canine leishmaniasis [PMC9235276].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCUGCCCGCAUGCCUGCCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus (cattle) bta-miR-346
  2. Capra hircus chi-miR-346-5p
  3. Cavia porcellus cpo-miR-346-5p
  4. Equus caballus (horse) eca-miR-346
  5. Homo sapiens (human) hsa-miR-346
  6. Macaca mulatta mml-miR-346
  7. Oryctolagus cuniculus (rabbit) ocu-miR-346-5p
  8. Pan troglodytes (chimpanzee) ptr-miR-346
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-346
  10. Pteropus alecto pal-miR-346-5p
  11. Sus scrofa (pig) ssc-mir165
Publications