Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-346 URS0000134ADC_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, MirGeneDB, LncBase, TarBase, RefSeq, GeneCards, miRBase, ENA). Described in 37 papers. Homo sapiens (human) hsa-miR-346 sequence is a product of miR-346, hsa-miR-346, MIR346 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 182-FIP, 60B8AG, 82-FIP, 8B, A1S9T, ABCC4, ACVR2B, AGAP3, AGO2, AGPAT5.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUCUGCCCGCAUGCCUGCCUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Bos taurus (cattle) bta-miR-346
    2. Canis lupus familiaris (dog) cfa-miR-346
    3. Capra hircus chi-miR-346-5p
    4. Cavia porcellus (domestic guinea pig) cpo-miR-346-5p
    5. Equus caballus eca-miR-346
    6. Macaca mulatta mml-miR-346
    7. Oryctolagus cuniculus ocu-miR-346-5p
    8. Pan troglodytes ptr-miR-346
    9. Pongo pygmaeus (Bornean orangutan) ppy-miR-346
    10. Pteropus alecto pal-miR-346-5p
    11. Sus scrofa (pig) ssc-mir165