v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae Sigma1278b tRNA-Glu (TTC) (tRNA-Glu-TTC-2-1) secondary structure diagram

Saccharomyces cerevisiae Sigma1278b tRNA-Glu (TTC) (tRNA-Glu-TTC-2-1) URS000012840E_658763

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCGAUAUAGUGUAACGGCUAUCACAUCACGCUUUCACCGUGGAGACCGGGGUUCGACUCCCCGUAGCGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Saccharomyces cerevisiae tRNA-Glu
  2. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Glu (TTC) (tRNA-Glu-TTC-2-1)
  3. Saccharomyces cerevisiae S288C tRNA-Glu
  4. Saccharomyces cerevisiae W303 tRNA-Glu (TTC) (tRNA-Glu-TTC-2-1)
  5. Vector YCy2508 tRNA-Glu
 2D structure Publications