Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Solanum tuberosum (potato) stu-miR166b URS0000127C0D_4113

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGACCAGGCUUCAUUCCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Ananas comosus microRNA 166d
  2. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR166d
  3. Cucumis melo cme-miR166e
  4. Cynara cardunculus var. scolymus cca-miR166a
  5. Digitalis purpurea dpr-miR166a
  6. Helianthus annuus (common sunflower) osa-miR166g-3p
  7. Linum usitatissimum (flax) lus-miR166e
  8. Medicago truncatula (barrel medic) mtr-miR166f
  9. Oryza sativa (Asian cultivated rice) osa-miR166h-3p
  10. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR166h-3p
  11. Picea abies (Norway spruce) pab-miR166a
  12. Salvia sclarea ssl-miR166a
  13. Solanum lycopersicum (tomato) sly-miR166c-3p
  14. Sorghum bicolor (sorghum) sbi-miR166f
  15. Theobroma cacao (cacao) tcc-miR166c
  16. Zea mays (maize) zma-miR166m-3p
Publications