Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR166h-3p URS0000127C0D_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR166g-3p: Osa-mir166g-3p is a microRNA that has been found to be differentially expressed in rice upon infection with the fungus R. solani [PMC9189367]. In the A3-A9 rice cultivars, the miR166 family, including osa-mir166g-3p, was down-regulated and targeted various genes, including homeobox-leucine zipper proteins and peroxidases [PMC4628322]. However, in the resistant cultivar Pankaj, osa-mir166g-3p was not downregulated and showed upregulation during R. solani infection [PMC7662745]. Additionally, osa-mir166g-3p was found to be downregulated during all time points of infection in rice [PMC7662745]. Furthermore, osa-mir166g-3p has been shown to target a START domain containing protein involved in response to abiotic stress and abscisic acid [PMC6042804]. In wild rice under chilling stress, osa-mir166g-3p was observed to be differentially expressed [PMC9002458]. Moreover, osa-mir166g-3p has been found to be highly expressed in 9311 under chilling stress compared to DC90 [PMC9002458]. Additionally, osa-mir166g-3p has been shown to share high sequence similarity with miR166 of other plant species [PMC3734165]. Furthermore, osa-mir166g-3p has been found to be highly expressed in five lines of rice [PMC5578646]. Finally, osa-mir166g-3p has been identified as one of the differentially expressed miRNAs targeted by various miRNA families that target members of the OsHDZIP subfamily III transcription factor family in rice [PMC9405480].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGACCAGGCUUCAUUCCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Ananas comosus microRNA 166d
  2. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR166d
  3. Cucumis melo cme-miR166e
  4. Cynara cardunculus var. scolymus cca-miR166a
  5. Digitalis purpurea dpr-miR166a
  6. Helianthus annuus (common sunflower) osa-miR166g-3p
  7. Linum usitatissimum (flax) lus-miR166e
  8. Medicago truncatula (barrel medic) mtr-miR166f
  9. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR166h-3p
  10. Picea abies (Norway spruce) pab-miR166a
  11. Salvia sclarea ssl-miR166a
  12. Solanum lycopersicum (tomato) sly-miR166c-3p
  13. Solanum tuberosum (potato) stu-miR166b
  14. Sorghum bicolor (sorghum) sbi-miR166f
  15. Theobroma cacao (cacao) tcc-miR166c
  16. Zea mays (maize) zma-miR166m-3p
Publications