Taeniopygia guttata (zebra finch) tgu-miR-31 URS000012175B_59729

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 14 other species
• 241 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AGGCAAGAUGUUGGCAUAGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

1. Alligator mississippiensis (American alligator) ami-miR-31-5p
2. Caenorhabditis remanei crm-miR-72-5p
3. Cervus elaphus cel-miR-31
4. Chrysemys picta (Painted turtle) cpi-miR-31-5p
5. Gallus gallus (chicken) gga-miR-31-5p
6. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-31
7. Maylandia zebra (zebra mbuna) mze-miR-31
8. Neolamprologus brichardi (lyretail cichlid) nbr-miR-31
9. Panagrellus redivivus prd-miR-72-5p
10. Patiria miniata (sea bat) Pmi-Mir-31-P4_5p (mature (guide))
11. Pristionchus pacificus ppc-miR-72
12. Saccoglossus kowalevskii sko-miR-31
13. Xenopus tropicalis xtr-miR-31a
14. Xenoturbella bocki Xbo-Mir-31_5p (mature (guide))

Publications Download

• FASTA
• JSON