Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) tgu-miR-31 URS000012175B_59729

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAAGAUGUUGGCAUAGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis (American alligator) ami-miR-31-5p
  2. Caenorhabditis remanei crm-miR-72-5p
  3. Cervus elaphus cel-miR-31
  4. Chrysemys picta (Painted turtle) cpi-miR-31-5p
  5. Gallus gallus (chicken) gga-miR-31-5p
  6. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-31
  7. Maylandia zebra (zebra mbuna) mze-miR-31
  8. Neolamprologus brichardi nbr-miR-31
  9. Panagrellus redivivus prd-miR-72-5p
  10. Patiria miniata Pmi-Mir-31-P5b_5p (mature (guide))
  11. Pristionchus pacificus ppc-miR-72
  12. Saccoglossus kowalevskii sko-miR-31
  13. Xenopus tropicalis xtr-miR-31a
  14. Xenoturbella bocki Xbo-Mir-31_5p (mature (guide))
Publications