Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Haplochromis burtoni (Burton's mouthbrooder) abu-miR-31 URS000012175B_8153

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAAGAUGUUGGCAUAGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Alligator mississippiensis (American alligator) ami-miR-31-5p
  2. Caenorhabditis remanei crm-miR-72-5p
  3. Cervus elaphus cel-miR-31
  4. Chrysemys picta (Painted turtle) cpi-miR-31-5p
  5. Gallus gallus (chicken) gga-miR-31-5p
  6. Maylandia zebra (zebra mbuna) mze-miR-31
  7. Neolamprologus brichardi (lyretail cichlid) nbr-miR-31
  8. Panagrellus redivivus prd-miR-72-5p
  9. Patiria miniata (sea bat) Pmi-Mir-31-P4_5p (mature (guide))
  10. Pristionchus pacificus ppc-miR-72
  11. Saccoglossus kowalevskii sko-miR-31
  12. Taeniopygia guttata tgu-miR-31
  13. Xenopus tropicalis xtr-miR-31a
  14. Xenoturbella bocki Xbo-Mir-31_5p (mature (guide))