Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Desulfobacca acetoxidans 5S rRNA secondary structure diagram

Desulfobacca acetoxidans 5S rRNA URS000011467F_60893

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCGGUGGCCAUACCACGGGGGUCACACCCGAUCCCAUCCCGAACUCGGAAGUUAAGCCCCGUCGGGCCGAUGAUACUACGUGGGCAGCUGCGUGGGAAAGUAGGACGCCGCCGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Desulfobacca acetoxidans DSM 11109 5S ribosomal RNA
  2. Desulfobacterales bacterium 5S ribosomal RNA
2D structure