v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Desulfobacterales bacterium (hydrocarbon metagenome) 5S ribosomal RNA secondary structure diagram

Desulfobacterales bacterium (hydrocarbon metagenome) 5S ribosomal RNA URS000011467F_2044940

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCGGUGGCCAUACCACGGGGGUCACACCCGAUCCCAUCCCGAACUCGGAAGUUAAGCCCCGUCGGGCCGAUGAUACUACGUGGGCAGCUGCGUGGGAAAGUAGGACGCCGCCGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Desulfobacca acetoxidans 5S rRNA
  2. Desulfobacca acetoxidans DSM 11109 5S ribosomal RNA
 2D structure