Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Streptomyces purpeofuscus 5S rRNA secondary structure diagram

Streptomyces purpeofuscus 5S rRNA URS0000110B50_67352

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUUCGGUGGUCAUAGCGUGAGGGAAACGCCCGGUUACAUUCCGAACCCGGAAGCUAAGCCUCACAGCGCCGAUGGUACUGCAGGGGGGACCCUGUGGGAGAGUAGGACGCCGCCGAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Kitasatospora setae 5S rRNA
  2. Kitasatospora setae KM-6054 5S ribosomal RNA
  3. Streptomyces sp. 5S rRNA
  4. Streptomyces sp. L-9-10 5S ribosomal RNA
2D structure