Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Kitasatospora setae KM-6054 5S ribosomal RNA secondary structure diagram

Kitasatospora setae KM-6054 5S ribosomal RNA URS0000110B50_452652

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUUCGGUGGUCAUAGCGUGAGGGAAACGCCCGGUUACAUUCCGAACCCGGAAGCUAAGCCUCACAGCGCCGAUGGUACUGCAGGGGGGACCCUGUGGGAGAGUAGGACGCCGCCGAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Kitasatospora setae 5S rRNA
  2. Kitasatospora purpeofusca Streptomyces purpeofuscus 5S rRNA
  3. Streptomyces sp. 5S rRNA
  4. Streptomyces sp. L-9-10 5S ribosomal RNA
2D structure