v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Streptomyces sp. 5S rRNA secondary structure diagram

Streptomyces sp. 5S rRNA URS0000110B50_1931

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUUCGGUGGUCAUAGCGUGAGGGAAACGCCCGGUUACAUUCCGAACCCGGAAGCUAAGCCUCACAGCGCCGAUGGUACUGCAGGGGGGACCCUGUGGGAGAGUAGGACGCCGCCGAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Kitasatospora setae 5S rRNA
  2. Kitasatospora setae KM-6054 5S ribosomal RNA
  3. Kitasatospora purpeofusca Streptomyces purpeofuscus 5S rRNA
  4. Streptomyces sp. L-9-10 5S ribosomal RNA
 2D structure