v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, Ro60-associated Y1 (RNY1) secondary structure diagram

Homo sapiens (human) RNA, Ro60-associated Y1 (RNY1) URS0000103047_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNY1: RNY1 is a type of misc-RNA biotype that represents over 60% of the reads [PMC8188706]. The pathway involving RNY1 does not affect the expression levels of miRNAs eluted by DDX6 IP, but it may function as a machinery to harness these miRNAs [PMC6166933]. The probe sequence used for detection of RNY1 is not provided in the given context. The alignment of all human Y RNAs, including RNY1, RNY4, and RNY5, shows that the UAUU motif is conserved among them [PMC8973356].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCUGGUCCGAAGGUAGUGAGUUAUCUCAAUUGAUUGUUCACAGUCAGUUACAGAUCGAACUCCUUGUUCUACUCUUUCCCCCCUUCUCACUACUGCACUUGACUAGUCUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Ailuropoda melanoleuca Y RNA (ENSAMEG00000021648.2)
  2. Aotus nancymaae Y RNA (ENSANAG00000007974.1)
  3. Callithrix jacchus Y RNA (ENSCJAG00000081826.1)
  4. Canis lupus dingo Y RNA (ENSCAFG00020020514.1)
  5. Canis lupus familiaris Y RNA (ENSCAFG00030009388.1, ENSCAFG00040008332.1, ENSCAFG00845011972.1)
  6. Cebus imitator Y RNA (ENSCCAG00000006543.1)
  7. Cercocebus atys Y RNA (ENSCATG00000021601.1)
  8. Chlorocebus sabaeus Y RNA (ENSCSAG00000024765.1)
  9. Felis catus Y RNA (ENSFCAG00000034101.2)
  10. Gorilla gorilla gorilla Y RNA (ENSGGOG00000029830.2)
  11. Lynx canadensis (Canada lynx) Y RNA (ENSLCNG00005001388.1)
  12. Macaca fascicularis Y RNA (ENSMFAG00000013160.2)
  13. Macaca mulatta Y RNA (ENSMMUG00000027349.3, ENSMMUG00000060897.1)
  14. Macaca nemestrina (Pig-tailed macaque) Y RNA (ENSMNEG00000009113.1)
  15. Mandrillus leucophaeus Y RNA (ENSMLEG00000019851.1)
  16. Nomascus leucogenys Y RNA (ENSNLEG00000034755.1)
  17. Pan paniscus (bonobo) Y RNA (ENSPPAG00000019141.1)
  18. Panthera pardus (leopard) Y RNA (ENSPPRG00000021483.1)
  19. Pan troglodytes Y RNA (ENSPTRG00000025284.2, ENSPTRG00000049987.1)
  20. Papio anubis (olive baboon) Y RNA (ENSPANG00000046460.1)
  21. Piliocolobus tephrosceles (Ugandan red Colobus) Y RNA (ENSPTEG00000030616.1)
  22. Pongo abelii Y RNA (ENSPPYG00000024929.2)
  23. Rhinopithecus bieti (Black snub-nosed monkey) Y RNA (ENSRBIG00000008524.1)
  24. Rhinopithecus roxellana (Golden snub-nosed monkey) Y RNA (ENSRROG00000013001.1)
  25. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) Y RNA (ENSSBOG00000015079.1)
  26. Suricata suricatta (meerkat) Y RNA (ENSSSUG00005000131.1)
  27. Theropithecus gelada Y RNA (ENSTGEG00000002329.1)
  28. Ursus americanus Y RNA (ENSUAMG00000015058.1)
  29. Vulpes vulpes (red fox) Y RNA (ENSVVUG00000016623.1)
 2D structure Publications