Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca fascicularis (Crab-eating macaque) Y RNA (ENSMFAG00000013160.2) secondary structure diagram

Macaca fascicularis (Crab-eating macaque) Y RNA (ENSMFAG00000013160.2) URS0000103047_9541

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUGGUCCGAAGGUAGUGAGUUAUCUCAAUUGAUUGUUCACAGUCAGUUACAGAUCGAACUCCUUGUUCUACUCUUUCCCCCCUUCUCACUACUGCACUUGACUAGUCUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Ailuropoda melanoleuca Y RNA (ENSAMEG00000021648.2)
  2. Aotus nancymaae Y RNA (ENSANAG00000007974.1)
  3. Callithrix jacchus Y RNA (ENSCJAG00000081826.1)
  4. Canis lupus dingo Y RNA (ENSCAFG00020020514.1)
  5. Canis lupus familiaris Y RNA (ENSCAFG00030009388.1, ENSCAFG00040008332.1, ENSCAFG00845011972.1)
  6. Cebus imitator Y RNA (ENSCCAG00000006543.1)
  7. Cercocebus atys Y RNA (ENSCATG00000021601.1)
  8. Chlorocebus sabaeus Y RNA (ENSCSAG00000024765.1)
  9. Felis catus Y RNA (ENSFCAG00000034101.2)
  10. Gorilla gorilla gorilla Y RNA (ENSGGOG00000029830.2)
  11. Homo sapiens RNA, Ro60-associated Y1 (RNY1)
  12. Lynx canadensis (Canada lynx) Y RNA (ENSLCNG00005001388.1)
  13. Macaca mulatta Y RNA (ENSMMUG00000027349.3, ENSMMUG00000060897.1)
  14. Macaca nemestrina (Pig-tailed macaque) Y RNA (ENSMNEG00000009113.1)
  15. Mandrillus leucophaeus Y RNA (ENSMLEG00000019851.1)
  16. Nomascus leucogenys Y RNA (ENSNLEG00000034755.1)
  17. Pan paniscus (bonobo) Y RNA (ENSPPAG00000019141.1)
  18. Panthera pardus (leopard) Y RNA (ENSPPRG00000021483.1)
  19. Pan troglodytes Y RNA (ENSPTRG00000025284.2, ENSPTRG00000049987.1)
  20. Papio anubis (olive baboon) Y RNA (ENSPANG00000046460.1)
  21. Piliocolobus tephrosceles (Ugandan red Colobus) Y RNA (ENSPTEG00000030616.1)
  22. Pongo abelii Y RNA (ENSPPYG00000024929.2)
  23. Rhinopithecus bieti (Black snub-nosed monkey) Y RNA (ENSRBIG00000008524.1)
  24. Rhinopithecus roxellana (Golden snub-nosed monkey) Y RNA (ENSRROG00000013001.1)
  25. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) Y RNA (ENSSBOG00000015079.1)
  26. Suricata suricatta (meerkat) Y RNA (ENSSSUG00005000131.1)
  27. Theropithecus gelada Y RNA (ENSTGEG00000002329.1)
  28. Ursus americanus Y RNA (ENSUAMG00000015058.1)
  29. Vulpes vulpes (red fox) Y RNA (ENSVVUG00000016623.1)
2D structure Publications