Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1228-3p URS0000100748_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1228: hsa-mir-1228 is a microRNA that has been used as an internal control in various studies [PMC7221502]. It has been used in combination with spike-in control cel-miR-39 and as an endogenous normalizer [PMC9778022]. hsa-mir-1228 has been associated with lung cancer [PMC9293659]. In a study comparing kidney tissues of healthy individuals and patients with DN, hsa-mir-1228 was found to be differentially expressed [PMC8616647]. It has also been reported to prevent cellular apoptosis by targeting the 3'UTR of MOAP1 mRNA [PMC8744590]. hsa-mir-1228 has been identified as a potential endogenous reference gene for circulating miRNAs in cancer patients [PMC7112021]. It was selected as a reference gene based on its stability assessed through different algorithms [PMC7112021]. Furthermore, hsa-mir-1228 has been found to be differentially expressed in breast cancer compared to normal tissues [PMC8004706]. It has also been identified as a hub miRNA within the miRNA network associated with good prognosis in breast cancer patients [PMC8004706]. Overall, hsa-mir-1228 is a microRNA that plays various roles and can be used as an internal control or reference gene in different studies.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCACACCUGCCUCGCCCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications