Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Medicago truncatula (barrel medic) mtr-miR164d URS00000FBCC2_3880

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAAGCAGGGCACAUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Ananas comosus (pineapple) microRNA 164f
  2. Fragaria vesca subsp. vesca fve-miR164c
  3. Manihot esculenta (cassava) mes-miR164d
  4. Nicotiana tabacum nta-miR164c
  5. Populus tomentosa Pto-miR164f
  6. Populus trichocarpa (black cottonwood) ptc-miR164f
  7. Prunus persica ppe-miR164d
  8. Ricinus communis rco-miR164d
  9. Solanum tuberosum (potato) stu-miR164-5p
  10. Theobroma cacao (cacao) tcc-miR164c
  11. Vitis vinifera vvi-miR164b
Publications