Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila yakuba dya-miR-307 URS00000FBB5F_7245

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCACAACCUCCUUGAGUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Anopheles gambiae (African malaria mosquito) aga-miR-307
  2. Bombyx mori bmo-miR-307-3p
  3. Daphnia pulex (common water flea) dpu-miR-307
  4. Drosophila ananassae dan-miR-307
  5. Drosophila erecta der-miR-307
  6. Drosophila grimshawi dgr-miR-307
  7. Drosophila melanogaster microRNA dme-miR-307a-3p
  8. Drosophila mojavensis dmo-miR-307
  9. Drosophila persimilis dpe-miR-307
  10. Drosophila pseudoobscura dps-miR-307a
  11. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294437_df_nrg
  12. Drosophila sechellia dse-miR-307
  13. Drosophila simulans dsi-miR-307
  14. Drosophila willistoni dwi-miR-307
  15. Ixodes scapularis isc-miR-307
  16. Tribolium castaneum (red flour beetle) tca-miR-307-3p