v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila erecta der-miR-307 URS00000FBB5F_7220

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCACAACCUCCUUGAGUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Anopheles gambiae (African malaria mosquito) aga-miR-307
  2. Bombyx mori bmo-miR-307-3p
  3. Daphnia pulex (common water flea) dpu-miR-307
  4. Drosophila ananassae dan-miR-307
  5. Drosophila grimshawi dgr-miR-307
  6. Drosophila melanogaster microRNA dme-miR-307a-3p
  7. Drosophila mojavensis dmo-miR-307
  8. Drosophila persimilis dpe-miR-307
  9. Drosophila pseudoobscura dps-miR-307a
  10. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294437_df_nrg
  11. Drosophila sechellia dse-miR-307
  12. Drosophila simulans dsi-miR-307
  13. Drosophila willistoni dwi-miR-307
  14. Drosophila yakuba dya-miR-307
  15. Ixodes scapularis isc-miR-307
  16. Tribolium castaneum (red flour beetle) tca-miR-307-3p