Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oreochromis niloticus (Nile tilapia) oni-miR-16b URS00000F8B2E_8128

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Oreochromis niloticus. Annotated by 1 database (miRBase). Found in the nile tilapia reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGCAGCACGUAAAUAUUGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Callorhinchus milii (elephant shark) Cmi-Mir-15-P2a_5p (mature (guide))
    2. Capra hircus chi-miR-16a-5p
    3. Cyprinus carpio (common carp) ccr-miR-16b
    4. Danio rerio dre-miR-16b
    5. Gadus morhua gmo-miR-16b-5p
    6. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-16b
    7. Ictalurus punctatus (channel catfish) ipu-miR-16b
    8. Latimeria chalumnae (coelacanth) Lch-Mir-15-P2c_5p (mature (guide))
    9. Lepisosteus oculatus (spotted gar) Loc-Mir-15-P2a_5p (mature (guide))
    10. Maylandia zebra (zebra mbuna) mze-miR-16b
    11. Monopterus albus Mal-Mir-15-P2a2_5p (mature (guide))
    12. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49519597
    13. Neolamprologus brichardi nbr-miR-16b
    14. Pundamilia nyererei pny-miR-16b
    15. Salmo salar (Atlantic salmon) ssa-miR-16a-5p
    16. Taeniopygia guttata tgu-miR-16b-5p
    17. Takifugu rubripes fru-miR-16
    18. Tetraodon nigroviridis tni-miR-16
    19. Tor tambroides miR-16b
    20. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-2936854