Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-16b URS00000F8B2E_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-mir-16b: dre-mir-16b is a microRNA that is up-regulated in cold acclimation in fish [PMC6953832]. Our data showed that dre-mir-16b mimics could protect ZF4 cells under cold stress, suggesting its role in cold acclimation [PMC6953832]. In addition to dre-mir-16b, the expression of numerous other miRNAs, including dre-miR-100-3p, was significantly altered in cold acclimated cells [PMC6953832]. The exact roles and mechanisms of dre-mir-16b in cold acclimation remain unclear [PMC6953832]. However, it has been reported that the expression of miR-16 increases in platelets under cold-storage conditions [PMC6953832]. Furthermore, our study showed that both dre-mir-16b and dre-miR-100-3p contribute to cold acclimation by regulating cell survival under cold stress [PMC6953832]. The introduction of dre-miR-100-3p inhibitor and dre-mir-16b mimics protected ZF4 cells under cold stress, suggesting their involvement in supporting cell viability during cold acclimation [PMC6953832]. Overall, the findings suggest that both dre-mir-16b and dre-miR-100 contribute to the process of cold acclimation by regulating cell survival. However, further research is needed to fully understand their roles and mechanisms in fish during this process.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACGUAAAUAUUGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Callorhinchus milii Cmi-Mir-15-P2a_5p (mature (guide))
  2. Capra hircus chi-miR-16a-5p
  3. Cyprinus carpio ccr-miR-16b
  4. Gadus morhua (Atlantic cod) gmo-miR-16b-5p
  5. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-16b
  6. Ictalurus punctatus ipu-miR-16b
  7. Latimeria chalumnae (coelacanth) Lch-Mir-15-P2c_5p (mature (guide))
  8. Lepisosteus oculatus Loc-Mir-15-P2a_5p (mature (guide))
  9. Maylandia zebra mze-miR-16b
  10. Monopterus albus Mal-Mir-15-P2a2_5p (mature (guide))
  11. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49519597
  12. Neolamprologus brichardi (lyretail cichlid) nbr-miR-16b
  13. Oreochromis niloticus oni-miR-16b
  14. Pundamilia nyererei pny-miR-16b
  15. Salmo salar ssa-miR-16a-5p
  16. Taeniopygia guttata (zebra finch) tgu-miR-16b-5p
  17. Takifugu rubripes fru-miR-16
  18. Tetraodon nigroviridis tni-miR-16
  19. Tor tambroides miR-16b
  20. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-2936854
Publications