Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Latimeria chalumnae (coelacanth) Lch-Mir-15-P2c_5p (mature (guide)) URS00000F8B2E_7897

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACGUAAAUAUUGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Callorhinchus milii (elephant shark) Cmi-Mir-15-P2a_5p (mature (guide))
  2. Capra hircus (goat) chi-miR-16a-5p
  3. Cyprinus carpio ccr-miR-16b
  4. Danio rerio dre-miR-16b
  5. Gadus morhua (Atlantic cod) gmo-miR-16b-5p
  6. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-16b
  7. Ictalurus punctatus ipu-miR-16b
  8. Lepisosteus oculatus Loc-Mir-15-P2a_5p (mature (guide))
  9. Maylandia zebra mze-miR-16b
  10. Monopterus albus Mal-Mir-15-P2a2_5p (mature (guide))
  11. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49519597
  12. Neolamprologus brichardi nbr-miR-16b
  13. Oreochromis niloticus oni-miR-16b
  14. Pundamilia nyererei pny-miR-16b
  15. Salmo salar ssa-miR-16a-5p
  16. Taeniopygia guttata (zebra finch) tgu-miR-16b-5p
  17. Takifugu rubripes fru-miR-16
  18. Tetraodon nigroviridis tni-miR-16
  19. Tor tambroides (Thai mahseer) miR-16b
  20. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2936854