Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-193b-5p URS00000E1DC5_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGGUUUUGAGGGCGAGAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus Bta-Mir-193-P1a_5p (mature (co-guide))
  2. Canis lupus familiaris (dog) cfa-miR-193b
  3. Capra hircus (goat) chi-miR-193b-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-193b-5p
  5. Cervus elaphus (red deer) cel-miR-193b
  6. Cricetulus griseus cgr-miR-193b-5p
  7. Dasypus novemcinctus dno-miR-193b-5p
  8. Gorilla gorilla gorilla ggo-miR-193b (MIR193B)
  9. Gorilla gorilla ggo-miR-193b
  10. Homo sapiens (human) hsa-miR-193b-5p
  11. Macaca mulatta (Rhesus monkey) mml-miR-193b-5p
  12. Monodelphis domestica (gray short-tailed opossum) mdo-miR-193b-5p
  13. Mus musculus mmu-miR-193b-5p
  14. Ornithorhynchus anatinus oan-miR-193-5p
  15. Pteropus alecto pal-miR-193b-5p
Publications