Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-miR-135a URS00000DF6D0_9925

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

chi-mir-135a: Chi-mir-135a is a miRNA that binds to XR_311113.2 via putative binding sites, along with three other miRNAs (chi-miR-424-5p, chi-miR-544-5p, and chi-miR-3955-5p) [PMC8762113]. Mutants of chi-mir-135a, chi-miR-424-5p, and chi-miR-544-5p were transfected into GK cells to confirm their binding to XR_311113.2 [PMC8762113]. The miRNA binding site regions and mutated regions of chi-mir-135a were cloned into pmirGLO vectors for further analysis [PMC8762113]. XR_311113.2 contains binding sites for all four miRNAs (chi-mir-135a, chi-miR-424-5p, chi-miR544-p, and chi-miR3955-p) [PMC8762113]. Chi-mir135a is also down-regulated in three prenatal stages and the neonatal stage [PMC5087842]. Additionally, there are 17 down-regulated miRNAs that are common between these stages including Chi mir 135a [PMC5087842]. These findings suggest that Chi mir 135a may play a role in prenatal development and neonatal stage regulation along with other down-regulated miRNAs [PMC5087842].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGGCUUUUUAUUCCUAUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 101 other species

  1. Alligator mississippiensis Ami-Mir-135-P2_5p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-135-5p
  3. Ateles geoffroyi age-miR-135
  4. Bos taurus bta-miR-135a
  5. Callithrix jacchus cja-miR-135
  6. Callorhinchus milii Cmi-Mir-135-P2_5p (mature (guide))
  7. Canis lupus familiaris cfa-miR-135a-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-135a-5p
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-135-P2_5p (mature (guide))
  10. Columba livia (rock pigeon) cli-miR-135-5p
  11. Danio rerio dre-miR-135a
  12. Dasypus novemcinctus dno-miR-135a-5p
  13. Echinops telfairi Ete-Mir-135-P2_5p (mature (guide))
  14. Eptatretus burgeri (inshore hagfish) Ebu-Mir-135-P10_5p (mature (guide))
  15. Equus caballus (horse) eca-miR-135a
  16. Gadus morhua Gmo-Mir-135-P2a_5p (mature (guide))
  17. Gallus gallus (chicken) gga-miR-135a-5p
  18. Gekko japonicus Gja-Mir-135-P2_5p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-135a (MIR135A)
  20. Gorilla gorilla ggo-miR-135a
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-135c-5p
  22. Homo sapiens hsa-miR-135a-5p
  23. Ictalurus punctatus (channel catfish) ipu-miR-135a
  24. Lagothrix lagotricha (brown woolly monkey) lla-miR-135
  25. Latimeria chalumnae Lch-Mir-135-P2_5p (mature (guide))
  26. Macaca mulatta mml-miR-135a-5p
  27. Maylandia zebra (zebra mbuna) mze-miR-135c
  28. Microcaecilia unicolor Mun-Mir-135-P2_5p (mature (guide))
  29. Monodelphis domestica mdo-miR-135a-5p
  30. Monopterus albus (swamp eel) Mal-Mir-135-P2a_5p (mature (guide))
  31. Mus musculus (house mouse) mmu-miR-135a-5p
  32. Neolamprologus brichardi nbr-miR-135c-5p
  33. Ophiophagus hannah oha-miR-135-5p
  34. Oreochromis niloticus (Nile tilapia) oni-miR-135c
  35. Ornithorhynchus anatinus oan-miR-135b-5p
  36. Oryctolagus cuniculus (rabbit) ocu-miR-135a-5p
  37. Pan paniscus (pygmy chimpanzee) ppa-miR-135
  38. Pan troglodytes ptr-miR-135a
  39. Petromyzon marinus (sea lamprey) pma-miR-135a-5p
  40. Pongo pygmaeus ppy-miR-135a
  41. Pundamilia nyererei pny-miR-135c-5p
  42. Python bivittatus pbv-miR-135-5p
  43. Rattus norvegicus rno-miR-135a-5p
  44. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-135-P2_5p (mature (guide))
  45. Scyliorhinus torazame (cloudy catshark) Sto-Mir-135-P2_5p (mature (guide))
  46. Sphenodon punctatus (tuatara) Spt-Mir-135-P2_5p (mature (guide))
  47. Sus scrofa ssc-miR-135
  48. Taeniopygia guttata tgu-miR-135a-5p
  49. Tupaia chinensis tch-miR-135a-5p
  50. Xenopus laevis Xla-Mir-135-P2d_5p (mature (co-guide))
  51. Xenopus tropicalis (tropical clawed frog) xtr-miR-135
Publications