Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Glu secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Glu URS00000D4623_559292

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (Rfam, IntAct, ENA, SGD, GtRNAdb). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C tRNA-Glu sequence is a product of tRNA-Glu-TTC-1-2, tRNA-Glu-TTC-1-1, tRNA-Glu-TTC-1-12, tRNA-Glu-TTC-1-11, tRNA-Glu-TTC-1-4, tRNA-Glu-TTC-1-8, tRNA-Glu-TTC-1-3, tRNA-Glu-TTC-1-13, tRNA-Glu-TTC-1-10, tRNA-Glu-TTC-1-6, SOE1, tRNA-Glu-TTC-1-9, tRNA-Glu-TTC-1-5, tRNA-Glu-TTC-1-7 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 3

According to IntAct, Saccharomyces cerevisiae S288C tRNA-Glu interacts with:

Interaction id Participant Synonyms
EBI-11685995 P53072 D6VVA2 EBI-24190 P53072 TAN1 YGL232W tan1_yeast
EBI-12520649 Q02908 D6W3T1 EBI-33957 ELP3 Gamma-toxin target 3 HPA1 Q02908 TOT3 YPL086C elp3_yeast tRNA uridine(34) acetyltransferase
EBI-12520639 Q06706 D6VZ19 EBI-9068 ELP1 Gamma-toxin target 1 IKI3 L3502.7 O00036 Protein IKI3 Q06706 TOT1 YLR384C elp1_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCCGAUAUAGUGUAACGGCUAUCACAUCACGCUUUCACCGUGGAGACCGGGGUUCGACUCCCCGUAUCGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 155 other species

    1. [Candida] glabrata tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 7)
    2. [Candida] glabrata CBS 138 tRNA tE(UUC)1
    3. Kazachstania africana CBS 2517 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 15)
    4. Kazachstania barnettii transfer RNA-Glu(TTC)
    5. Kazachstania exigua tRNA-Glu
    6. Kazachstania saulgeensis tRNA
    7. Kluyveromyces dobzhanskii CBS 2104 tRNA-Glu
    8. Kluyveromyces lactis tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 8)
    9. Kluyveromyces marxianus DMKU3-1042 tRNA
    10. Kluyveromyces marxianus tRNA-Glu
    11. Kluyveromyces marxianus var. marxianus KCTC 17555 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 8)
    12. Lachancea dasiensis tRNA
    13. Lachancea dasiensis tRNA-Glu (TTC) cove score=62.99
    14. Lachancea fermentati tRNA
    15. Lachancea kluyveri NRRL Y-12651 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    16. Lachancea lanzarotensis tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 8)
    17. Lachancea meyersii CBS 8951 tRNA-Glu (TTC) cove score=62.99
    18. Lachancea mirantina tRNA
    19. Lachancea sp. CBS 6924 tRNA-Glu (TTC) cove score=62.99
    20. Naumovozyma castellii CBS 4309 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 12)
    21. Naumovozyma dairenensis CBS 421 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 12)
    22. Saccharomyces arboricola H-6 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
    23. Saccharomyces boulardii (nom. inval.) tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
    24. Saccharomyces cerevisiae AWRI796 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    25. Saccharomyces cerevisiae tRNA
    26. Saccharomyces cerevisiae CBS 7960 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
    27. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    28. Saccharomyces cerevisiae CLIB215 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    29. Saccharomyces cerevisiae CLIB324 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
    30. Saccharomyces cerevisiae CLIB382 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 6)
    31. Saccharomyces cerevisiae EC1118 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    32. Saccharomyces cerevisiae EC9-8 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    33. Saccharomyces cerevisiae FL100 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 12)
    34. Saccharomyces cerevisiae FostersB tRNA-Glu (TTC) (tRNA-Glu-TTC-2 1 to 13)
    35. Saccharomyces cerevisiae FostersO tRNA
    36. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 16)
    37. Saccharomyces cerevisiae Lalvin QA23 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 12)
    38. Saccharomyces cerevisiae P283 tRNA-Glu (TTC) (tRNA-Glu-TTC-2 1 to 11)
    39. Saccharomyces cerevisiae P301 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    40. Saccharomyces cerevisiae PE-2 tRNA-Glu
    41. Saccharomyces cerevisiae PW5 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 9)
    42. Saccharomyces cerevisiae R008 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    43. Saccharomyces cerevisiae R103 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
    44. Saccharomyces cerevisiae RM11-1a tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
    45. Saccharomyces cerevisiae Sigma1278b tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 12)
    46. Saccharomyces cerevisiae T73 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
    47. Saccharomyces cerevisiae T7 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
    48. Saccharomyces cerevisiae UC5 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 10)
    49. Saccharomyces cerevisiae UFMG A-905 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    50. Saccharomyces cerevisiae Vin13 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    51. Saccharomyces cerevisiae VL3 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    52. Saccharomyces cerevisiae W303 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    53. Saccharomyces cerevisiae Y10 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 8)
    54. Saccharomyces cerevisiae YJM1078 tRNA-Glu
    55. Saccharomyces cerevisiae YJM1083 tRNA-Glu
    56. Saccharomyces cerevisiae YJM1129 tRNA-Glu
    57. Saccharomyces cerevisiae YJM1133 tRNA-Glu
    58. Saccharomyces cerevisiae YJM1190 tRNA-Glu
    59. Saccharomyces cerevisiae YJM1199 tRNA-Glu
    60. Saccharomyces cerevisiae YJM1202 tRNA-Glu
    61. Saccharomyces cerevisiae YJM1208 tRNA-Glu
    62. Saccharomyces cerevisiae YJM1242 tRNA-Glu
    63. Saccharomyces cerevisiae YJM1244 tRNA-Glu
    64. Saccharomyces cerevisiae YJM1248 tRNA-Glu
    65. Saccharomyces cerevisiae YJM1250 tRNA-Glu
    66. Saccharomyces cerevisiae YJM1252 tRNA-Glu
    67. Saccharomyces cerevisiae YJM1273 tRNA-Glu
    68. Saccharomyces cerevisiae YJM1304 tRNA-Glu
    69. Saccharomyces cerevisiae YJM1307 tRNA-Glu
    70. Saccharomyces cerevisiae YJM1311 tRNA-Glu
    71. Saccharomyces cerevisiae YJM1326 tRNA-Glu
    72. Saccharomyces cerevisiae YJM1332 tRNA-Glu
    73. Saccharomyces cerevisiae YJM1336 tRNA-Glu
    74. Saccharomyces cerevisiae YJM1338 tRNA-Glu
    75. Saccharomyces cerevisiae YJM1341 tRNA-Glu
    76. Saccharomyces cerevisiae YJM1342 tRNA-Glu
    77. Saccharomyces cerevisiae YJM1355 tRNA-Glu
    78. Saccharomyces cerevisiae YJM1356 tRNA-Glu
    79. Saccharomyces cerevisiae YJM1381 tRNA-Glu
    80. Saccharomyces cerevisiae YJM1383 tRNA-Glu
    81. Saccharomyces cerevisiae YJM1385 tRNA-Glu
    82. Saccharomyces cerevisiae YJM1386 tRNA-Glu
    83. Saccharomyces cerevisiae YJM1387 tRNA-Glu
    84. Saccharomyces cerevisiae YJM1388 tRNA-Glu
    85. Saccharomyces cerevisiae YJM1389 tRNA-Glu
    86. Saccharomyces cerevisiae YJM1399 tRNA-Glu
    87. Saccharomyces cerevisiae YJM1400 tRNA-Glu
    88. Saccharomyces cerevisiae YJM1401 tRNA-Glu
    89. Saccharomyces cerevisiae YJM1402 tRNA-Glu
    90. Saccharomyces cerevisiae YJM1415 tRNA-Glu
    91. Saccharomyces cerevisiae YJM1417 tRNA-Glu
    92. Saccharomyces cerevisiae YJM1418 tRNA-Glu
    93. Saccharomyces cerevisiae YJM1419 tRNA-Glu
    94. Saccharomyces cerevisiae YJM1433 tRNA-Glu
    95. Saccharomyces cerevisiae YJM1434 tRNA-Glu
    96. Saccharomyces cerevisiae YJM1439 tRNA-Glu
    97. Saccharomyces cerevisiae YJM1443 tRNA-Glu
    98. Saccharomyces cerevisiae YJM1444 tRNA-Glu
    99. Saccharomyces cerevisiae YJM1447 tRNA-Glu
    100. Saccharomyces cerevisiae YJM1450 tRNA-Glu
    101. Saccharomyces cerevisiae YJM1460 tRNA-Glu
    102. Saccharomyces cerevisiae YJM1463 tRNA-Glu
    103. Saccharomyces cerevisiae YJM1477 tRNA-Glu
    104. Saccharomyces cerevisiae YJM1478 tRNA-Glu
    105. Saccharomyces cerevisiae YJM1479 tRNA-Glu
    106. Saccharomyces cerevisiae YJM1526 tRNA-Glu
    107. Saccharomyces cerevisiae YJM1527 tRNA-Glu
    108. Saccharomyces cerevisiae YJM1549 tRNA-Glu
    109. Saccharomyces cerevisiae YJM1573 tRNA-Glu
    110. Saccharomyces cerevisiae YJM1574 tRNA-Glu
    111. Saccharomyces cerevisiae YJM1592 tRNA-Glu
    112. Saccharomyces cerevisiae YJM1615 tRNA-Glu
    113. Saccharomyces cerevisiae YJM189 tRNA-Glu
    114. Saccharomyces cerevisiae YJM193 tRNA-Glu
    115. Saccharomyces cerevisiae YJM195 tRNA-Glu
    116. Saccharomyces cerevisiae YJM244 tRNA-Glu
    117. Saccharomyces cerevisiae YJM248 tRNA-Glu
    118. Saccharomyces cerevisiae YJM269 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    119. Saccharomyces cerevisiae YJM270 tRNA-Glu
    120. Saccharomyces cerevisiae YJM271 tRNA-Glu
    121. Saccharomyces cerevisiae YJM320 tRNA-Glu
    122. Saccharomyces cerevisiae YJM326 tRNA-Glu
    123. Saccharomyces cerevisiae YJM428 tRNA-Glu
    124. Saccharomyces cerevisiae YJM450 tRNA-Glu
    125. Saccharomyces cerevisiae YJM451 tRNA-Glu
    126. Saccharomyces cerevisiae YJM453 tRNA-Glu
    127. Saccharomyces cerevisiae YJM456 tRNA-Glu
    128. Saccharomyces cerevisiae YJM470 tRNA-Glu
    129. Saccharomyces cerevisiae YJM541 tRNA-Glu
    130. Saccharomyces cerevisiae YJM554 tRNA-Glu
    131. Saccharomyces cerevisiae YJM555 tRNA-Glu
    132. Saccharomyces cerevisiae YJM627 tRNA-Glu
    133. Saccharomyces cerevisiae YJM681 tRNA-Glu
    134. Saccharomyces cerevisiae YJM682 tRNA-Glu
    135. Saccharomyces cerevisiae YJM683 tRNA-Glu
    136. Saccharomyces cerevisiae YJM689 tRNA-Glu
    137. Saccharomyces cerevisiae YJM693 tRNA-Glu
    138. Saccharomyces cerevisiae YJM969 tRNA-Glu
    139. Saccharomyces cerevisiae YJM972 tRNA-Glu
    140. Saccharomyces cerevisiae YJM975 tRNA-Glu
    141. Saccharomyces cerevisiae YJM978 tRNA-Glu
    142. Saccharomyces cerevisiae YJM981 tRNA-Glu
    143. Saccharomyces cerevisiae YJM984 tRNA-Glu
    144. Saccharomyces cerevisiae YJM987 tRNA-Glu
    145. Saccharomyces cerevisiae YJM990 tRNA-Glu
    146. Saccharomyces cerevisiae YJM993 tRNA-Glu
    147. Saccharomyces cerevisiae YJM996 tRNA-Glu
    148. Saccharomyces cerevisiae YJSH1 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
    149. Saccharomyces eubayanus tRNA-Glu
    150. Saccharomyces kudriavzevii IFO 1802 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
    151. Saccharomyces pastorianus tRNA-Glu
    152. Tetrapisispora blattae CBS 6284 tRNA-Glu (TTC) (tRNA-Glu-TTC-3 1 to 12)
    153. Tetrapisispora phaffii CBS 4417 tRNA-Glu (TTC) (tRNA-Glu-TTC-1-1)
    154. Vanderwaltozyma polyspora DSM 70294 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 12)
    155. Xanthomonas citri pv. citri tRNA-Glu
    2D structure Publications New