Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1447 tRNA-Glu secondary structure diagram

Saccharomyces cerevisiae YJM1447 tRNA-Glu URS00000D4623_1294375

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCGAUAUAGUGUAACGGCUAUCACAUCACGCUUUCACCGUGGAGACCGGGGUUCGACUCCCCGUAUCGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 163 other species

  1. Nakaseomyces glabratus CBS 138 tRNA tE(UUC)1
  2. Fusarium falciforme tRNA-Glu
  3. Fusarium oxysporum tRNA-Glu
  4. Kazachstania africana CBS 2517 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 15)
  5. Kazachstania barnettii transfer RNA-Glu(TTC)
  6. Kazachstania bulderi transfer RNA-Glu(TTC)
  7. Kazachstania exigua tRNA-Glu
  8. Kazachstania saulgeensis tRNA
  9. Kluyveromyces dobzhanskii CBS 2104 tRNA-Glu
  10. Kluyveromyces lactis tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 8)
  11. Kluyveromyces marxianus DMKU3-1042 tRNA
  12. Kluyveromyces marxianus tRNA-Glu
  13. Kluyveromyces marxianus var. marxianus KCTC 17555 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 8)
  14. Lachancea dasiensis tRNA
  15. Lachancea dasiensis tRNA-Glu (TTC) cove score=62.99
  16. Lachancea fermentati tRNA
  17. Lachancea kluyveri NRRL Y-12651 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  18. Lachancea lanzarotensis tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 8)
  19. Lachancea meyersii CBS 8951 tRNA-Glu (TTC) cove score=62.99
  20. Lachancea mirantina tRNA
  21. Lachancea sp. 'fantastica' tRNA-Glu (TTC) cove score=62.99
  22. Nakaseomyces glabratus tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 7)
  23. Naumovozyma castellii CBS 4309 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 12)
  24. Naumovozyma dairenensis CBS 421 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 12)
  25. Saccharomyces arboricola H-6 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
  26. Saccharomyces boulardii (nom. inval.) tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
  27. Saccharomyces cerevisiae AWRI796 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  28. Saccharomyces cerevisiae tRNA
  29. Saccharomyces cerevisiae CBS 7960 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
  30. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  31. Saccharomyces cerevisiae CLIB215 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  32. Saccharomyces cerevisiae CLIB324 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
  33. Saccharomyces cerevisiae CLIB382 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 6)
  34. Saccharomyces cerevisiae EC1118 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  35. Saccharomyces cerevisiae EC9-8 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  36. Saccharomyces cerevisiae FL100 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 12)
  37. Saccharomyces cerevisiae FostersB tRNA-Glu (TTC) (tRNA-Glu-TTC-2 1 to 13)
  38. Saccharomyces cerevisiae FostersO tRNA
  39. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 16)
  40. Saccharomyces cerevisiae Lalvin QA23 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 12)
  41. Saccharomyces cerevisiae P283 tRNA-Glu (TTC) (tRNA-Glu-TTC-2 1 to 11)
  42. Saccharomyces cerevisiae P301 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  43. Saccharomyces cerevisiae PE-2 tRNA-Glu
  44. Saccharomyces cerevisiae PW5 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 9)
  45. Saccharomyces cerevisiae R008 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  46. Saccharomyces cerevisiae R103 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
  47. Saccharomyces cerevisiae RM11-1a tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
  48. Saccharomyces cerevisiae S288C tRNA-Glu
  49. Saccharomyces cerevisiae Sigma1278b tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 12)
  50. Saccharomyces cerevisiae synthetic construct tRNA-Glu
  51. Saccharomyces cerevisiae T73 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
  52. Saccharomyces cerevisiae T7 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
  53. Saccharomyces cerevisiae UC5 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 10)
  54. Saccharomyces cerevisiae UFMG A-905 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  55. Saccharomyces cerevisiae Vin13 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  56. Saccharomyces cerevisiae VL3 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  57. Saccharomyces cerevisiae W303 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  58. Saccharomyces cerevisiae Y10 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 8)
  59. Saccharomyces cerevisiae YJM1078 tRNA-Glu
  60. Saccharomyces cerevisiae YJM1083 tRNA-Glu
  61. Saccharomyces cerevisiae YJM1129 tRNA-Glu
  62. Saccharomyces cerevisiae YJM1133 tRNA-Glu
  63. Saccharomyces cerevisiae YJM1190 tRNA-Glu
  64. Saccharomyces cerevisiae YJM1199 tRNA-Glu
  65. Saccharomyces cerevisiae YJM1202 tRNA-Glu
  66. Saccharomyces cerevisiae YJM1208 tRNA-Glu
  67. Saccharomyces cerevisiae YJM1242 tRNA-Glu
  68. Saccharomyces cerevisiae YJM1244 tRNA-Glu
  69. Saccharomyces cerevisiae YJM1248 tRNA-Glu
  70. Saccharomyces cerevisiae YJM1250 tRNA-Glu
  71. Saccharomyces cerevisiae YJM1252 tRNA-Glu
  72. Saccharomyces cerevisiae YJM1273 tRNA-Glu
  73. Saccharomyces cerevisiae YJM1304 tRNA-Glu
  74. Saccharomyces cerevisiae YJM1307 tRNA-Glu
  75. Saccharomyces cerevisiae YJM1311 tRNA-Glu
  76. Saccharomyces cerevisiae YJM1326 tRNA-Glu
  77. Saccharomyces cerevisiae YJM1332 tRNA-Glu
  78. Saccharomyces cerevisiae YJM1336 tRNA-Glu
  79. Saccharomyces cerevisiae YJM1338 tRNA-Glu
  80. Saccharomyces cerevisiae YJM1341 tRNA-Glu
  81. Saccharomyces cerevisiae YJM1342 tRNA-Glu
  82. Saccharomyces cerevisiae YJM1355 tRNA-Glu
  83. Saccharomyces cerevisiae YJM1356 tRNA-Glu
  84. Saccharomyces cerevisiae YJM1381 tRNA-Glu
  85. Saccharomyces cerevisiae YJM1383 tRNA-Glu
  86. Saccharomyces cerevisiae YJM1385 tRNA-Glu
  87. Saccharomyces cerevisiae YJM1386 tRNA-Glu
  88. Saccharomyces cerevisiae YJM1387 tRNA-Glu
  89. Saccharomyces cerevisiae YJM1388 tRNA-Glu
  90. Saccharomyces cerevisiae YJM1389 tRNA-Glu
  91. Saccharomyces cerevisiae YJM1399 tRNA-Glu
  92. Saccharomyces cerevisiae YJM1400 tRNA-Glu
  93. Saccharomyces cerevisiae YJM1401 tRNA-Glu
  94. Saccharomyces cerevisiae YJM1402 tRNA-Glu
  95. Saccharomyces cerevisiae YJM1415 tRNA-Glu
  96. Saccharomyces cerevisiae YJM1417 tRNA-Glu
  97. Saccharomyces cerevisiae YJM1418 tRNA-Glu
  98. Saccharomyces cerevisiae YJM1419 tRNA-Glu
  99. Saccharomyces cerevisiae YJM1433 tRNA-Glu
  100. Saccharomyces cerevisiae YJM1434 tRNA-Glu
  101. Saccharomyces cerevisiae YJM1439 tRNA-Glu
  102. Saccharomyces cerevisiae YJM1443 tRNA-Glu
  103. Saccharomyces cerevisiae YJM1444 tRNA-Glu
  104. Saccharomyces cerevisiae YJM1450 tRNA-Glu
  105. Saccharomyces cerevisiae YJM1460 tRNA-Glu
  106. Saccharomyces cerevisiae YJM1463 tRNA-Glu
  107. Saccharomyces cerevisiae YJM1477 tRNA-Glu
  108. Saccharomyces cerevisiae YJM1478 tRNA-Glu
  109. Saccharomyces cerevisiae YJM1479 tRNA-Glu
  110. Saccharomyces cerevisiae YJM1526 tRNA-Glu
  111. Saccharomyces cerevisiae YJM1527 tRNA-Glu
  112. Saccharomyces cerevisiae YJM1549 tRNA-Glu
  113. Saccharomyces cerevisiae YJM1573 tRNA-Glu
  114. Saccharomyces cerevisiae YJM1574 tRNA-Glu
  115. Saccharomyces cerevisiae YJM1592 tRNA-Glu
  116. Saccharomyces cerevisiae YJM1615 tRNA-Glu
  117. Saccharomyces cerevisiae YJM189 tRNA-Glu
  118. Saccharomyces cerevisiae YJM193 tRNA-Glu
  119. Saccharomyces cerevisiae YJM195 tRNA-Glu
  120. Saccharomyces cerevisiae YJM244 tRNA-Glu
  121. Saccharomyces cerevisiae YJM248 tRNA-Glu
  122. Saccharomyces cerevisiae YJM269 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  123. Saccharomyces cerevisiae YJM270 tRNA-Glu
  124. Saccharomyces cerevisiae YJM271 tRNA-Glu
  125. Saccharomyces cerevisiae YJM320 tRNA-Glu
  126. Saccharomyces cerevisiae YJM326 tRNA-Glu
  127. Saccharomyces cerevisiae YJM428 tRNA-Glu
  128. Saccharomyces cerevisiae YJM450 tRNA-Glu
  129. Saccharomyces cerevisiae YJM451 tRNA-Glu
  130. Saccharomyces cerevisiae YJM453 tRNA-Glu
  131. Saccharomyces cerevisiae YJM456 tRNA-Glu
  132. Saccharomyces cerevisiae YJM470 tRNA-Glu
  133. Saccharomyces cerevisiae YJM541 tRNA-Glu
  134. Saccharomyces cerevisiae YJM554 tRNA-Glu
  135. Saccharomyces cerevisiae YJM555 tRNA-Glu
  136. Saccharomyces cerevisiae YJM627 tRNA-Glu
  137. Saccharomyces cerevisiae YJM681 tRNA-Glu
  138. Saccharomyces cerevisiae YJM682 tRNA-Glu
  139. Saccharomyces cerevisiae YJM683 tRNA-Glu
  140. Saccharomyces cerevisiae YJM689 tRNA-Glu
  141. Saccharomyces cerevisiae YJM693 tRNA-Glu
  142. Saccharomyces cerevisiae YJM969 tRNA-Glu
  143. Saccharomyces cerevisiae YJM972 tRNA-Glu
  144. Saccharomyces cerevisiae YJM975 tRNA-Glu
  145. Saccharomyces cerevisiae YJM978 tRNA-Glu
  146. Saccharomyces cerevisiae YJM981 tRNA-Glu
  147. Saccharomyces cerevisiae YJM984 tRNA-Glu
  148. Saccharomyces cerevisiae YJM987 tRNA-Glu
  149. Saccharomyces cerevisiae YJM990 tRNA-Glu
  150. Saccharomyces cerevisiae YJM993 tRNA-Glu
  151. Saccharomyces cerevisiae YJM996 tRNA-Glu
  152. Saccharomyces cerevisiae YJSH1 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 14)
  153. Saccharomyces eubayanus tRNA-Glu
  154. Saccharomyces kudriavzevii IFO 1802 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 13)
  155. Saccharomyces kudriavzevii ZP591 tRNA-Glu
  156. Saccharomyces mikatae IFO 1815 tRNA-Glu
  157. Saccharomyces pastorianus tRNA-Glu
  158. Saccharomyces uvarum tRNA-Glu
  159. Tetrapisispora blattae CBS 6284 tRNA-Glu (TTC) (tRNA-Glu-TTC-3 1 to 12)
  160. Tetrapisispora phaffii CBS 4417 tRNA-Glu (TTC) (tRNA-Glu-TTC-1-1)
  161. Vanderwaltozyma polyspora DSM 70294 tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 12)
  162. Vector YCy2508 tRNA-Glu
  163. Xanthomonas citri pv. citri tRNA-Glu
2D structure